Incidental Mutation 'R3885:Mgst3'
ID308701
Institutional Source Beutler Lab
Gene Symbol Mgst3
Ensembl Gene ENSMUSG00000026688
Gene Namemicrosomal glutathione S-transferase 3
Synonyms2010306B17Rik, GST-III, 2700004G04Rik, 2010012L10Rik
MMRRC Submission 040905-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3885 (G1)
Quality Score224
Status Validated
Chromosome1
Chromosomal Location167371966-167393841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 167372562 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 135 (Q135K)
Ref Sequence ENSEMBL: ENSMUSP00000028005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028004] [ENSMUST00000028005]
Predicted Effect probably benign
Transcript: ENSMUST00000028004
SMART Domains Protein: ENSMUSP00000028004
Gene: ENSMUSG00000026687

DomainStartEndE-ValueType
Pfam:Aldedh 46 507 1.5e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028005
AA Change: Q135K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000028005
Gene: ENSMUSG00000026688
AA Change: Q135K

DomainStartEndE-ValueType
Pfam:MAPEG 11 134 8.9e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191715
Meta Mutation Damage Score 0.0770 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) protein family. Members of this family are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. This gene encodes an enzyme which catalyzes the conjugation of leukotriene A4 and reduced glutathione to produce leukotriene C4. This enzyme also demonstrates glutathione-dependent peroxidase activity towards lipid hydroperoxides.[provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak8 G A 2: 28,733,885 V161I possibly damaging Het
Ank3 A T 10: 69,899,036 I792F probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Boc T C 16: 44,487,613 probably benign Het
Bptf G A 11: 107,074,513 T1170M probably damaging Het
Ccdc85a T A 11: 28,576,677 E310D probably benign Het
Cfap221 A G 1: 119,954,146 probably null Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Eif2s1 T A 12: 78,881,225 I225N probably damaging Het
Ephb2 C T 4: 136,771,034 G245S probably damaging Het
Exoc4 T C 6: 33,266,131 probably null Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gck T C 11: 5,910,318 Y108C probably damaging Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gm5145 A T 17: 20,571,010 T217S probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gpr150 T C 13: 76,056,538 Q96R probably damaging Het
Hist1h2ae G T 13: 23,570,879 T77K possibly damaging Het
Hist1h2an A G 13: 21,786,869 L117P probably damaging Het
Itga2 A T 13: 114,869,299 H448Q probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Lrriq1 T C 10: 103,216,106 I262V probably damaging Het
Nrxn1 T A 17: 90,623,471 T766S probably damaging Het
Olfr736 A T 14: 50,392,869 I38F probably benign Het
Ovch2 A G 7: 107,796,568 I81T probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rictor A T 15: 6,759,610 N236Y probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Senp7 A G 16: 56,186,079 E922G probably damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Usp40 A T 1: 87,967,269 L843Q probably damaging Het
Vmn2r97 C T 17: 18,928,334 L164F possibly damaging Het
Wiz G T 17: 32,357,038 A798E possibly damaging Het
Other mutations in Mgst3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0744:Mgst3 UTSW 1 167373805 missense probably damaging 1.00
R1283:Mgst3 UTSW 1 167378296 missense possibly damaging 0.74
R1594:Mgst3 UTSW 1 167373810 missense probably damaging 0.99
R2267:Mgst3 UTSW 1 167373799 missense probably benign 0.23
R4659:Mgst3 UTSW 1 167377279 missense probably damaging 1.00
R6139:Mgst3 UTSW 1 167378305 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCAGGAGCTTTAGGTATGAGGC -3'
(R):5'- TCTAGCGTACTGGTGGCTCTAG -3'

Sequencing Primer
(F):5'- AGCTTTAGGTATGAGGCTGATGC -3'
(R):5'- TAGAGTTGGCCAACCTCCC -3'
Posted On2015-04-17