Incidental Mutation 'R3885:Steap4'
ID 308706
Institutional Source Beutler Lab
Gene Symbol Steap4
Ensembl Gene ENSMUSG00000012428
Gene Name STEAP family member 4
Synonyms Tnfaip9, Tiarp
MMRRC Submission 040905-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R3885 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 8010472-8032213 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 8030494 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 450 (R450L)
Ref Sequence ENSEMBL: ENSMUSP00000111081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115421]
AlphaFold Q923B6
Predicted Effect probably damaging
Transcript: ENSMUST00000115421
AA Change: R450L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428
AA Change: R450L

DomainStartEndE-ValueType
Pfam:F420_oxidored 21 107 2.3e-16 PFAM
transmembrane domain 203 225 N/A INTRINSIC
Pfam:Ferric_reduct 247 395 2.6e-14 PFAM
transmembrane domain 416 438 N/A INTRINSIC
Meta Mutation Damage Score 0.4460 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak8 G A 2: 28,623,897 (GRCm39) V161I possibly damaging Het
Ank3 A T 10: 69,734,866 (GRCm39) I792F probably damaging Het
B930094E09Rik G A 18: 31,742,742 (GRCm39) S59N unknown Het
Boc T C 16: 44,307,976 (GRCm39) probably benign Het
Bptf G A 11: 106,965,339 (GRCm39) T1170M probably damaging Het
Ccdc85a T A 11: 28,526,677 (GRCm39) E310D probably benign Het
Cfap221 A G 1: 119,881,876 (GRCm39) probably null Het
Dmxl1 T A 18: 50,011,326 (GRCm39) M1161K probably damaging Het
Eif2ak1 A T 5: 143,821,479 (GRCm39) Q265L probably benign Het
Eif2s1 T A 12: 78,927,999 (GRCm39) I225N probably damaging Het
Ephb2 C T 4: 136,498,345 (GRCm39) G245S probably damaging Het
Exoc4 T C 6: 33,243,066 (GRCm39) probably null Het
Foxd2 T C 4: 114,765,483 (GRCm39) H179R unknown Het
Gck T C 11: 5,860,318 (GRCm39) Y108C probably damaging Het
Gjc3 T A 5: 137,956,105 (GRCm39) N60I possibly damaging Het
Gm5145 A T 17: 20,791,272 (GRCm39) T217S probably benign Het
Gpc5 T C 14: 115,607,472 (GRCm39) M358T probably benign Het
Gpr150 T C 13: 76,204,657 (GRCm39) Q96R probably damaging Het
H2ac22 A G 13: 21,971,039 (GRCm39) L117P probably damaging Het
H2ac8 G T 13: 23,755,053 (GRCm39) T77K possibly damaging Het
Itga2 A T 13: 115,005,835 (GRCm39) H448Q probably benign Het
Lcor T A 19: 41,546,795 (GRCm39) S126R probably damaging Het
Lrch2 C G X: 146,256,003 (GRCm39) A437P probably damaging Het
Lrriq1 T C 10: 103,051,967 (GRCm39) I262V probably damaging Het
Mgst3 G T 1: 167,200,131 (GRCm39) Q135K probably benign Het
Nrxn1 T A 17: 90,930,899 (GRCm39) T766S probably damaging Het
Or11j4 A T 14: 50,630,326 (GRCm39) I38F probably benign Het
Ovch2 A G 7: 107,395,775 (GRCm39) I81T probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rictor A T 15: 6,789,091 (GRCm39) N236Y probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Rreb1 G T 13: 38,077,941 (GRCm39) R51L probably damaging Het
Senp7 A G 16: 56,006,442 (GRCm39) E922G probably damaging Het
Slc15a2 A G 16: 36,602,666 (GRCm39) F65S probably damaging Het
Slitrk5 T A 14: 111,917,229 (GRCm39) C284* probably null Het
Usp40 A T 1: 87,894,991 (GRCm39) L843Q probably damaging Het
Vmn2r97 C T 17: 19,148,596 (GRCm39) L164F possibly damaging Het
Wiz G T 17: 32,576,012 (GRCm39) A798E possibly damaging Het
Other mutations in Steap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Steap4 APN 5 8,026,979 (GRCm39) missense probably damaging 1.00
IGL00827:Steap4 APN 5 8,026,712 (GRCm39) missense probably damaging 1.00
IGL01481:Steap4 APN 5 8,026,858 (GRCm39) missense probably damaging 0.98
IGL02378:Steap4 APN 5 8,026,741 (GRCm39) missense probably benign 0.00
IGL03058:Steap4 APN 5 8,025,664 (GRCm39) missense probably benign 0.00
PIT4362001:Steap4 UTSW 5 8,030,337 (GRCm39) missense probably benign 0.03
R0329:Steap4 UTSW 5 8,025,829 (GRCm39) missense possibly damaging 0.92
R0546:Steap4 UTSW 5 8,025,870 (GRCm39) missense probably damaging 0.99
R0637:Steap4 UTSW 5 8,028,398 (GRCm39) splice site probably benign
R0638:Steap4 UTSW 5 8,027,030 (GRCm39) splice site probably benign
R0651:Steap4 UTSW 5 8,030,348 (GRCm39) nonsense probably null
R0881:Steap4 UTSW 5 8,030,388 (GRCm39) missense probably benign
R1167:Steap4 UTSW 5 8,026,520 (GRCm39) missense probably benign 0.34
R1543:Steap4 UTSW 5 8,025,902 (GRCm39) splice site probably benign
R1889:Steap4 UTSW 5 8,025,892 (GRCm39) missense probably damaging 1.00
R3803:Steap4 UTSW 5 8,026,979 (GRCm39) missense probably damaging 1.00
R3811:Steap4 UTSW 5 8,027,017 (GRCm39) missense probably benign 0.18
R3887:Steap4 UTSW 5 8,030,494 (GRCm39) missense probably damaging 1.00
R4051:Steap4 UTSW 5 8,030,404 (GRCm39) missense probably damaging 1.00
R4208:Steap4 UTSW 5 8,030,404 (GRCm39) missense probably damaging 1.00
R5016:Steap4 UTSW 5 8,026,699 (GRCm39) nonsense probably null
R5302:Steap4 UTSW 5 8,025,547 (GRCm39) nonsense probably null
R5951:Steap4 UTSW 5 8,025,769 (GRCm39) missense probably benign 0.00
R6136:Steap4 UTSW 5 8,028,562 (GRCm39) missense probably damaging 0.99
R6527:Steap4 UTSW 5 8,028,502 (GRCm39) missense probably damaging 0.99
R6631:Steap4 UTSW 5 8,026,995 (GRCm39) nonsense probably null
R6964:Steap4 UTSW 5 8,025,568 (GRCm39) missense probably damaging 1.00
R7055:Steap4 UTSW 5 8,026,858 (GRCm39) missense probably damaging 1.00
R7408:Steap4 UTSW 5 8,028,453 (GRCm39) missense probably benign 0.07
R7692:Steap4 UTSW 5 8,026,976 (GRCm39) missense probably benign 0.32
R8205:Steap4 UTSW 5 8,026,795 (GRCm39) missense possibly damaging 0.65
R8861:Steap4 UTSW 5 8,025,672 (GRCm39) missense probably benign 0.00
R9287:Steap4 UTSW 5 8,026,683 (GRCm39) missense probably benign 0.05
R9423:Steap4 UTSW 5 8,026,720 (GRCm39) missense probably damaging 0.99
R9504:Steap4 UTSW 5 8,030,538 (GRCm39) missense probably benign 0.00
R9531:Steap4 UTSW 5 8,028,424 (GRCm39) missense probably benign 0.20
R9566:Steap4 UTSW 5 8,025,646 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TAGTCCAAACTGGGTTATCTGACC -3'
(R):5'- GTGAGGCAACACTTCCTACTGTG -3'

Sequencing Primer
(F):5'- TGACCCTGGTCTTGTGCACAG -3'
(R):5'- CCTACTGTGATGATAAAGTTAGGGCC -3'
Posted On 2015-04-17