Incidental Mutation 'R3885:Eif2ak1'
ID308708
Institutional Source Beutler Lab
Gene Symbol Eif2ak1
Ensembl Gene ENSMUSG00000029613
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 1
SynonymsHri
MMRRC Submission 040905-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R3885 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143817788-143904251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143884661 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 265 (Q265L)
Ref Sequence ENSEMBL: ENSMUSP00000098056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100487]
Predicted Effect probably benign
Transcript: ENSMUST00000100487
AA Change: Q265L

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098056
Gene: ENSMUSG00000029613
AA Change: Q265L

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 62 81 N/A INTRINSIC
Pfam:Pkinase_Tyr 167 242 5.6e-6 PFAM
Pfam:Pkinase 167 257 1.9e-15 PFAM
low complexity region 314 320 N/A INTRINSIC
Pfam:Pkinase 365 580 1.3e-31 PFAM
Pfam:Pkinase_Tyr 373 578 1.9e-19 PFAM
coiled coil region 585 619 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140013
Meta Mutation Damage Score 0.1578 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts at the level of translation initiation to downregulate protein synthesis in response to stress. The encoded protein is a kinase that can be inactivated by hemin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit enlarged heart size and abnormal red blood cell development, morphology, and physiology with macrocytic anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak8 G A 2: 28,733,885 V161I possibly damaging Het
Ank3 A T 10: 69,899,036 I792F probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Boc T C 16: 44,487,613 probably benign Het
Bptf G A 11: 107,074,513 T1170M probably damaging Het
Ccdc85a T A 11: 28,576,677 E310D probably benign Het
Cfap221 A G 1: 119,954,146 probably null Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2s1 T A 12: 78,881,225 I225N probably damaging Het
Ephb2 C T 4: 136,771,034 G245S probably damaging Het
Exoc4 T C 6: 33,266,131 probably null Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gck T C 11: 5,910,318 Y108C probably damaging Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gm5145 A T 17: 20,571,010 T217S probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gpr150 T C 13: 76,056,538 Q96R probably damaging Het
Hist1h2ae G T 13: 23,570,879 T77K possibly damaging Het
Hist1h2an A G 13: 21,786,869 L117P probably damaging Het
Itga2 A T 13: 114,869,299 H448Q probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Lrriq1 T C 10: 103,216,106 I262V probably damaging Het
Mgst3 G T 1: 167,372,562 Q135K probably benign Het
Nrxn1 T A 17: 90,623,471 T766S probably damaging Het
Olfr736 A T 14: 50,392,869 I38F probably benign Het
Ovch2 A G 7: 107,796,568 I81T probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rictor A T 15: 6,759,610 N236Y probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Senp7 A G 16: 56,186,079 E922G probably damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Usp40 A T 1: 87,967,269 L843Q probably damaging Het
Vmn2r97 C T 17: 18,928,334 L164F possibly damaging Het
Wiz G T 17: 32,357,038 A798E possibly damaging Het
Other mutations in Eif2ak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Eif2ak1 APN 5 143889470 missense probably damaging 0.99
IGL02170:Eif2ak1 APN 5 143879460 missense probably benign 0.01
IGL02472:Eif2ak1 APN 5 143884883 missense probably benign 0.00
IGL02898:Eif2ak1 APN 5 143889452 missense probably damaging 1.00
IGL03078:Eif2ak1 APN 5 143873769 missense probably benign 0.02
PIT4520001:Eif2ak1 UTSW 5 143899209 nonsense probably null
R0523:Eif2ak1 UTSW 5 143882166 missense probably damaging 1.00
R0755:Eif2ak1 UTSW 5 143884924 missense possibly damaging 0.94
R1128:Eif2ak1 UTSW 5 143899176 unclassified probably null
R1203:Eif2ak1 UTSW 5 143883979 missense probably benign 0.00
R1445:Eif2ak1 UTSW 5 143873899 splice site probably benign
R1474:Eif2ak1 UTSW 5 143871967 missense probably damaging 1.00
R1972:Eif2ak1 UTSW 5 143884714 missense probably benign 0.04
R3889:Eif2ak1 UTSW 5 143884661 missense probably benign 0.21
R4754:Eif2ak1 UTSW 5 143901803 missense probably damaging 0.99
R4971:Eif2ak1 UTSW 5 143882168 missense probably damaging 1.00
R5007:Eif2ak1 UTSW 5 143873880 missense probably benign
R5487:Eif2ak1 UTSW 5 143897163 critical splice acceptor site probably null
R5505:Eif2ak1 UTSW 5 143817990 missense probably benign
R5808:Eif2ak1 UTSW 5 143883994 missense probably benign 0.21
R5888:Eif2ak1 UTSW 5 143886915 missense probably damaging 1.00
R6290:Eif2ak1 UTSW 5 143884799 missense probably benign 0.34
R6322:Eif2ak1 UTSW 5 143899095 missense probably benign 0.05
R6475:Eif2ak1 UTSW 5 143818010 unclassified probably null
R7343:Eif2ak1 UTSW 5 143877671 missense probably damaging 1.00
R7525:Eif2ak1 UTSW 5 143886898 missense probably damaging 1.00
R7554:Eif2ak1 UTSW 5 143879478 missense probably damaging 1.00
R7659:Eif2ak1 UTSW 5 143889462 missense probably damaging 1.00
X0027:Eif2ak1 UTSW 5 143879435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGCTGCCCAGATTTGAC -3'
(R):5'- GGACGATTCACTTTCACTGC -3'

Sequencing Primer
(F):5'- TTAAGACAGTGTCCCATGTAGCGC -3'
(R):5'- GCTGTTCCTGACCACTAAGTTGG -3'
Posted On2015-04-17