Incidental Mutation 'R3885:Hist1h2an'
ID308720
Institutional Source Beutler Lab
Gene Symbol Hist1h2an
Ensembl Gene ENSMUSG00000069309
Gene Namehistone cluster 1, H2an
Synonyms
MMRRC Submission 040905-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R3885 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21786826-21787218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21786869 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 117 (L117P)
Ref Sequence ENSEMBL: ENSMUSP00000089345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091751] [ENSMUST00000102982] [ENSMUST00000110473] [ENSMUST00000189457]
Predicted Effect probably damaging
Transcript: ENSMUST00000091751
AA Change: L117P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089345
Gene: ENSMUSG00000069309
AA Change: L117P

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102982
SMART Domains Protein: ENSMUSP00000100047
Gene: ENSMUSG00000069308

DomainStartEndE-ValueType
H2B 28 124 4.64e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110473
SMART Domains Protein: ENSMUSP00000106099
Gene: ENSMUSG00000069308

DomainStartEndE-ValueType
H2B 28 124 4.64e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189457
SMART Domains Protein: ENSMUSP00000139663
Gene: ENSMUSG00000101972

DomainStartEndE-ValueType
H3 34 136 1.5e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198851
Meta Mutation Damage Score 0.6248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak8 G A 2: 28,733,885 V161I possibly damaging Het
Ank3 A T 10: 69,899,036 I792F probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Boc T C 16: 44,487,613 probably benign Het
Bptf G A 11: 107,074,513 T1170M probably damaging Het
Ccdc85a T A 11: 28,576,677 E310D probably benign Het
Cfap221 A G 1: 119,954,146 probably null Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Eif2s1 T A 12: 78,881,225 I225N probably damaging Het
Ephb2 C T 4: 136,771,034 G245S probably damaging Het
Exoc4 T C 6: 33,266,131 probably null Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gck T C 11: 5,910,318 Y108C probably damaging Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gm5145 A T 17: 20,571,010 T217S probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gpr150 T C 13: 76,056,538 Q96R probably damaging Het
Hist1h2ae G T 13: 23,570,879 T77K possibly damaging Het
Itga2 A T 13: 114,869,299 H448Q probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Lrriq1 T C 10: 103,216,106 I262V probably damaging Het
Mgst3 G T 1: 167,372,562 Q135K probably benign Het
Nrxn1 T A 17: 90,623,471 T766S probably damaging Het
Olfr736 A T 14: 50,392,869 I38F probably benign Het
Ovch2 A G 7: 107,796,568 I81T probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rictor A T 15: 6,759,610 N236Y probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Senp7 A G 16: 56,186,079 E922G probably damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Usp40 A T 1: 87,967,269 L843Q probably damaging Het
Vmn2r97 C T 17: 18,928,334 L164F possibly damaging Het
Wiz G T 17: 32,357,038 A798E possibly damaging Het
Other mutations in Hist1h2an
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Hist1h2an APN 13 21786921 missense probably benign 0.43
R5506:Hist1h2an UTSW 13 21786911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGATCGGAGAAACAGATTCCTTC -3'
(R):5'- TTTAGAATGTCTGGACGCGG -3'

Sequencing Primer
(F):5'- TCGGAGAAACAGATTCCTTCTATAG -3'
(R):5'- ATGTCTGGACGCGGCAAAC -3'
Posted On2015-04-17