Incidental Mutation 'R3885:Gpc5'
ID308727
Institutional Source Beutler Lab
Gene Symbol Gpc5
Ensembl Gene ENSMUSG00000022112
Gene Nameglypican 5
SynonymsA230034F01Rik
MMRRC Submission 040905-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3885 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location115092215-116525179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115370060 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 358 (M358T)
Ref Sequence ENSEMBL: ENSMUSP00000135085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022707] [ENSMUST00000175665] [ENSMUST00000176912]
Predicted Effect probably benign
Transcript: ENSMUST00000022707
AA Change: M285T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022707
Gene: ENSMUSG00000022112
AA Change: M285T

DomainStartEndE-ValueType
Pfam:Glypican 9 572 1.8e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175665
AA Change: M358T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135857
Gene: ENSMUSG00000022112
AA Change: M358T

DomainStartEndE-ValueType
Pfam:Glypican 82 480 1.3e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176912
AA Change: M358T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135085
Gene: ENSMUSG00000022112
AA Change: M358T

DomainStartEndE-ValueType
Pfam:Glypican 85 642 1.6e-174 PFAM
Meta Mutation Damage Score 0.0903 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak8 G A 2: 28,733,885 V161I possibly damaging Het
Ank3 A T 10: 69,899,036 I792F probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Boc T C 16: 44,487,613 probably benign Het
Bptf G A 11: 107,074,513 T1170M probably damaging Het
Ccdc85a T A 11: 28,576,677 E310D probably benign Het
Cfap221 A G 1: 119,954,146 probably null Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Eif2s1 T A 12: 78,881,225 I225N probably damaging Het
Ephb2 C T 4: 136,771,034 G245S probably damaging Het
Exoc4 T C 6: 33,266,131 probably null Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gck T C 11: 5,910,318 Y108C probably damaging Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gm5145 A T 17: 20,571,010 T217S probably benign Het
Gpr150 T C 13: 76,056,538 Q96R probably damaging Het
Hist1h2ae G T 13: 23,570,879 T77K possibly damaging Het
Hist1h2an A G 13: 21,786,869 L117P probably damaging Het
Itga2 A T 13: 114,869,299 H448Q probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Lrriq1 T C 10: 103,216,106 I262V probably damaging Het
Mgst3 G T 1: 167,372,562 Q135K probably benign Het
Nrxn1 T A 17: 90,623,471 T766S probably damaging Het
Olfr736 A T 14: 50,392,869 I38F probably benign Het
Ovch2 A G 7: 107,796,568 I81T probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rictor A T 15: 6,759,610 N236Y probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Senp7 A G 16: 56,186,079 E922G probably damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Usp40 A T 1: 87,967,269 L843Q probably damaging Het
Vmn2r97 C T 17: 18,928,334 L164F possibly damaging Het
Wiz G T 17: 32,357,038 A798E possibly damaging Het
Other mutations in Gpc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Gpc5 APN 14 115370024 missense probably damaging 1.00
IGL01298:Gpc5 APN 14 115399188 missense probably benign 0.14
IGL01359:Gpc5 APN 14 115369750 missense possibly damaging 0.74
IGL02354:Gpc5 APN 14 115133287 nonsense probably null
IGL02361:Gpc5 APN 14 115133287 nonsense probably null
IGL02982:Gpc5 APN 14 115369988 missense probably damaging 1.00
IGL03120:Gpc5 APN 14 115370144 missense possibly damaging 0.64
R0322:Gpc5 UTSW 14 115399151 missense probably benign 0.05
R0396:Gpc5 UTSW 14 115428208 missense possibly damaging 0.91
R0555:Gpc5 UTSW 14 115552328 missense probably damaging 0.98
R0629:Gpc5 UTSW 14 115552239 missense possibly damaging 0.94
R1536:Gpc5 UTSW 14 115399250 missense probably benign 0.09
R1660:Gpc5 UTSW 14 115399279 missense probably benign 0.12
R1676:Gpc5 UTSW 14 115370098 missense probably damaging 1.00
R2328:Gpc5 UTSW 14 115788179 missense probably damaging 0.99
R3522:Gpc5 UTSW 14 116524335 missense probably benign 0.00
R3776:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R3889:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R3893:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R4041:Gpc5 UTSW 14 115133216 missense probably damaging 1.00
R4517:Gpc5 UTSW 14 115552239 missense possibly damaging 0.94
R5068:Gpc5 UTSW 14 115417264 makesense probably null
R5639:Gpc5 UTSW 14 115092747 missense probably benign 0.13
R5730:Gpc5 UTSW 14 115788314 missense possibly damaging 0.73
R5944:Gpc5 UTSW 14 115369838 missense probably benign 0.24
R6351:Gpc5 UTSW 14 115399200 missense probably benign 0.01
R6557:Gpc5 UTSW 14 115092534 unclassified probably benign
R6657:Gpc5 UTSW 14 115370198 missense probably benign 0.01
R6714:Gpc5 UTSW 14 115552303 nonsense probably null
R6751:Gpc5 UTSW 14 115369951 missense probably benign 0.00
R7057:Gpc5 UTSW 14 115133242 missense possibly damaging 0.64
R7142:Gpc5 UTSW 14 115417203 missense probably benign 0.01
R7225:Gpc5 UTSW 14 115552298 missense probably damaging 1.00
R7544:Gpc5 UTSW 14 115428173 missense probably damaging 1.00
R7658:Gpc5 UTSW 14 115428208 missense possibly damaging 0.91
R7695:Gpc5 UTSW 14 115092594 missense unknown
R7785:Gpc5 UTSW 14 115417220 missense probably benign 0.00
R8116:Gpc5 UTSW 14 115399225 missense probably damaging 0.98
R8303:Gpc5 UTSW 14 115428255 missense probably benign 0.01
RF001:Gpc5 UTSW 14 115417178 missense probably benign 0.41
RF022:Gpc5 UTSW 14 115552276 missense probably damaging 1.00
Z1176:Gpc5 UTSW 14 115369964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGCTTAATCTGGGCATTG -3'
(R):5'- TGTGTGTACCCTACCTAGATTTTGC -3'

Sequencing Primer
(F):5'- TTGAGGTCATCAACACCACGG -3'
(R):5'- TTCTAAGAAATTAGATGGAAGGCCC -3'
Posted On2015-04-17