Mutagenetix > Incidental Mutations

Incidental Mutation 'R3885:Lcor'

308738

Institutional Source

Beutler Lab

Gene Symbol

Lcor

Ensembl Gene

ENSMUSG00000025019

Gene Name

ligand dependent nuclear receptor corepressor

Synonyms

A630025C20Rik, Mlr2, 3110023F06Rik

MMRRC Submission

040905-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.858) question?

Stock #

R3885 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41482645-41562246 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41558356 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 126 (S126R)

Ref Sequence

ENSEMBL: ENSMUSP00000126441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067795] [ENSMUST00000163929]

AlphaFold

Q6ZPI3

Predicted Effect

probably damaging
Transcript: ENSMUST00000067795
AA Change: S126R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000067603
Gene: ENSMUSG00000025019
AA Change: S126R

Domain	Start	End	E-Value	Type
low complexity region	36	48	N/A	INTRINSIC
Pfam:HTH_psq	350	395	1.2e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163929
AA Change: S126R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126441
Gene: ENSMUSG00000025019
AA Change: S126R

Domain	Start	End	E-Value	Type
low complexity region	36	48	N/A	INTRINSIC
Pfam:HTH_psq	350	395	5.1e-18	PFAM

Meta Mutation Damage Score

0.0834

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LCOR is a transcriptional corepressor widely expressed in fetal and adult tissues that is recruited to agonist-bound nuclear receptors through a single LxxLL motif, also referred to as a nuclear receptor (NR) box (Fernandes et al., 2003 [PubMed 12535528]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak8	G	A	2: 28,733,885	V161I	possibly damaging	Het
Ank3	A	T	10: 69,899,036	I792F	probably damaging	Het
B930094E09Rik	G	A	18: 31,609,689	S59N	unknown	Het
Boc	T	C	16: 44,487,613		probably benign	Het
Bptf	G	A	11: 107,074,513	T1170M	probably damaging	Het
Ccdc85a	T	A	11: 28,576,677	E310D	probably benign	Het
Cfap221	A	G	1: 119,954,146		probably null	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Eif2ak1	A	T	5: 143,884,661	Q265L	probably benign	Het
Eif2s1	T	A	12: 78,881,225	I225N	probably damaging	Het
Ephb2	C	T	4: 136,771,034	G245S	probably damaging	Het
Exoc4	T	C	6: 33,266,131		probably null	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Gck	T	C	11: 5,910,318	Y108C	probably damaging	Het
Gjc3	T	A	5: 137,957,843	N60I	possibly damaging	Het
Gm5145	A	T	17: 20,571,010	T217S	probably benign	Het
Gpc5	T	C	14: 115,370,060	M358T	probably benign	Het
Gpr150	T	C	13: 76,056,538	Q96R	probably damaging	Het
Hist1h2ae	G	T	13: 23,570,879	T77K	possibly damaging	Het
Hist1h2an	A	G	13: 21,786,869	L117P	probably damaging	Het
Itga2	A	T	13: 114,869,299	H448Q	probably benign	Het
Lrch2	C	G	X: 147,473,007	A437P	probably damaging	Het
Lrriq1	T	C	10: 103,216,106	I262V	probably damaging	Het
Mgst3	G	T	1: 167,372,562	Q135K	probably benign	Het
Nrxn1	T	A	17: 90,623,471	T766S	probably damaging	Het
Olfr736	A	T	14: 50,392,869	I38F	probably benign	Het
Ovch2	A	G	7: 107,796,568	I81T	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rictor	A	T	15: 6,759,610	N236Y	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rreb1	G	T	13: 37,893,965	R51L	probably damaging	Het
Senp7	A	G	16: 56,186,079	E922G	probably damaging	Het
Slc15a2	A	G	16: 36,782,304	F65S	probably damaging	Het
Slitrk5	T	A	14: 111,679,797	C284*	probably null	Het
Steap4	G	T	5: 7,980,494	R450L	probably damaging	Het
Usp40	A	T	1: 87,967,269	L843Q	probably damaging	Het
Vmn2r97	C	T	17: 18,928,334	L164F	possibly damaging	Het
Wiz	G	T	17: 32,357,038	A798E	possibly damaging	Het

Other mutations in Lcor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00737:Lcor	APN	19	41552700	missense	probably damaging	0.97
IGL02079:Lcor	APN	19	41555687	missense	probably benign	0.40
IGL02100:Lcor	APN	19	41558754	missense	possibly damaging	0.93
IGL02444:Lcor	APN	19	41559011	missense	probably damaging	0.99
IGL02578:Lcor	APN	19	41559150	missense	probably damaging	1.00
IGL03072:Lcor	APN	19	41558814	missense	possibly damaging	0.85
IGL03118:Lcor	APN	19	41558369	missense	probably damaging	0.99
IGL03153:Lcor	APN	19	41558356	missense	probably damaging	0.98
R1756:Lcor	UTSW	19	41559266	missense	probably benign
R1889:Lcor	UTSW	19	41559128	missense	probably damaging	0.99
R1913:Lcor	UTSW	19	41558474	missense	probably benign	0.40
R1983:Lcor	UTSW	19	41558367	missense	probably damaging	0.98
R3886:Lcor	UTSW	19	41558356	missense	probably damaging	0.98
R3888:Lcor	UTSW	19	41558356	missense	probably damaging	0.98
R3889:Lcor	UTSW	19	41558356	missense	probably damaging	0.98
R5160:Lcor	UTSW	19	41555614	missense	probably damaging	0.99
R6112:Lcor	UTSW	19	41559081	missense	possibly damaging	0.92
R7777:Lcor	UTSW	19	41558795	missense	probably benign	0.33
R8556:Lcor	UTSW	19	41558424	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AACTAACTGCTGAGACCATGTG -3'
(R):5'- CTGTCCGTGATTCTGTAATCCAG -3'

Sequencing Primer
(F):5'- AATAAAGGAGTGGTCCCC -3'
(R):5'- TCTGTAATCCAGACGGACCAAGG -3'

Posted On

2015-04-17