Incidental Mutation 'R3885:Lcor'
ID 308738
Institutional Source Beutler Lab
Gene Symbol Lcor
Ensembl Gene ENSMUSG00000025019
Gene Name ligand dependent nuclear receptor corepressor
Synonyms A630025C20Rik, Mlr2, 3110023F06Rik
MMRRC Submission 040905-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock # R3885 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 41482645-41562246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 41558356 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 126 (S126R)
Ref Sequence ENSEMBL: ENSMUSP00000126441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067795] [ENSMUST00000163929]
AlphaFold Q6ZPI3
Predicted Effect probably damaging
Transcript: ENSMUST00000067795
AA Change: S126R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067603
Gene: ENSMUSG00000025019
AA Change: S126R

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Pfam:HTH_psq 350 395 1.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163929
AA Change: S126R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126441
Gene: ENSMUSG00000025019
AA Change: S126R

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Pfam:HTH_psq 350 395 5.1e-18 PFAM
Meta Mutation Damage Score 0.0834 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LCOR is a transcriptional corepressor widely expressed in fetal and adult tissues that is recruited to agonist-bound nuclear receptors through a single LxxLL motif, also referred to as a nuclear receptor (NR) box (Fernandes et al., 2003 [PubMed 12535528]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak8 G A 2: 28,733,885 V161I possibly damaging Het
Ank3 A T 10: 69,899,036 I792F probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Boc T C 16: 44,487,613 probably benign Het
Bptf G A 11: 107,074,513 T1170M probably damaging Het
Ccdc85a T A 11: 28,576,677 E310D probably benign Het
Cfap221 A G 1: 119,954,146 probably null Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Eif2s1 T A 12: 78,881,225 I225N probably damaging Het
Ephb2 C T 4: 136,771,034 G245S probably damaging Het
Exoc4 T C 6: 33,266,131 probably null Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gck T C 11: 5,910,318 Y108C probably damaging Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gm5145 A T 17: 20,571,010 T217S probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gpr150 T C 13: 76,056,538 Q96R probably damaging Het
Hist1h2ae G T 13: 23,570,879 T77K possibly damaging Het
Hist1h2an A G 13: 21,786,869 L117P probably damaging Het
Itga2 A T 13: 114,869,299 H448Q probably benign Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Lrriq1 T C 10: 103,216,106 I262V probably damaging Het
Mgst3 G T 1: 167,372,562 Q135K probably benign Het
Nrxn1 T A 17: 90,623,471 T766S probably damaging Het
Olfr736 A T 14: 50,392,869 I38F probably benign Het
Ovch2 A G 7: 107,796,568 I81T probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rictor A T 15: 6,759,610 N236Y probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Senp7 A G 16: 56,186,079 E922G probably damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Usp40 A T 1: 87,967,269 L843Q probably damaging Het
Vmn2r97 C T 17: 18,928,334 L164F possibly damaging Het
Wiz G T 17: 32,357,038 A798E possibly damaging Het
Other mutations in Lcor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Lcor APN 19 41552700 missense probably damaging 0.97
IGL02079:Lcor APN 19 41555687 missense probably benign 0.40
IGL02100:Lcor APN 19 41558754 missense possibly damaging 0.93
IGL02444:Lcor APN 19 41559011 missense probably damaging 0.99
IGL02578:Lcor APN 19 41559150 missense probably damaging 1.00
IGL03072:Lcor APN 19 41558814 missense possibly damaging 0.85
IGL03118:Lcor APN 19 41558369 missense probably damaging 0.99
IGL03153:Lcor APN 19 41558356 missense probably damaging 0.98
R1756:Lcor UTSW 19 41559266 missense probably benign
R1889:Lcor UTSW 19 41559128 missense probably damaging 0.99
R1913:Lcor UTSW 19 41558474 missense probably benign 0.40
R1983:Lcor UTSW 19 41558367 missense probably damaging 0.98
R3886:Lcor UTSW 19 41558356 missense probably damaging 0.98
R3888:Lcor UTSW 19 41558356 missense probably damaging 0.98
R3889:Lcor UTSW 19 41558356 missense probably damaging 0.98
R5160:Lcor UTSW 19 41555614 missense probably damaging 0.99
R6112:Lcor UTSW 19 41559081 missense possibly damaging 0.92
R7777:Lcor UTSW 19 41558795 missense probably benign 0.33
R8556:Lcor UTSW 19 41558424 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACTAACTGCTGAGACCATGTG -3'
(R):5'- CTGTCCGTGATTCTGTAATCCAG -3'

Sequencing Primer
(F):5'- AATAAAGGAGTGGTCCCC -3'
(R):5'- TCTGTAATCCAGACGGACCAAGG -3'
Posted On 2015-04-17