Incidental Mutation 'R3881:Zfp106'
ID 308746
Institutional Source Beutler Lab
Gene Symbol Zfp106
Ensembl Gene ENSMUSG00000027288
Gene Name zinc finger protein 106
Synonyms Cd-1, H3a, Sh3bp3, sirm
MMRRC Submission 040795-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3881 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 120337301-120394324 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120362630 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 830 (S830P)
Ref Sequence ENSEMBL: ENSMUSP00000128995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000135625] [ENSMUST00000171215]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000055241
AA Change: S853P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: S853P

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
ZnF_C2H2 43 67 7.18e1 SMART
low complexity region 75 92 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 199 212 N/A INTRINSIC
low complexity region 466 480 N/A INTRINSIC
coiled coil region 800 823 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
low complexity region 1312 1321 N/A INTRINSIC
low complexity region 1361 1373 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
WD40 1525 1562 9.24e-4 SMART
WD40 1565 1607 1.83e-7 SMART
PQQ 1587 1618 3.42e2 SMART
WD40 1651 1691 3.45e-1 SMART
PQQ 1671 1702 9.14e1 SMART
WD40 1694 1731 2.12e-3 SMART
PQQ 1711 1742 6.42e0 SMART
WD40 1734 1771 6e-3 SMART
PQQ 1751 1782 5.7e2 SMART
WD40 1774 1811 3.58e-1 SMART
ZnF_C2H2 1818 1843 5.34e-1 SMART
ZnF_C2H2 1851 1879 1.31e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135625
AA Change: S64P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000126939
Gene: ENSMUSG00000027288
AA Change: S64P

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
low complexity region 53 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149210
Predicted Effect probably benign
Transcript: ENSMUST00000163384
Predicted Effect probably benign
Transcript: ENSMUST00000171215
AA Change: S830P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: S830P

DomainStartEndE-ValueType
ZnF_C2H2 20 44 7.18e1 SMART
low complexity region 52 69 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 176 189 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
coiled coil region 777 800 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1289 1298 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1366 1386 N/A INTRINSIC
WD40 1502 1539 9.24e-4 SMART
WD40 1542 1584 1.83e-7 SMART
PQQ 1564 1595 3.42e2 SMART
WD40 1628 1668 3.45e-1 SMART
PQQ 1648 1679 9.14e1 SMART
WD40 1671 1708 2.12e-3 SMART
PQQ 1688 1719 6.42e0 SMART
WD40 1711 1748 6e-3 SMART
PQQ 1728 1759 5.7e2 SMART
WD40 1751 1788 3.58e-1 SMART
ZnF_C2H2 1795 1820 5.34e-1 SMART
ZnF_C2H2 1828 1856 1.31e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181963
Predicted Effect probably benign
Transcript: ENSMUST00000167241
SMART Domains Protein: ENSMUSP00000127803
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 4 28 1.51e0 SMART
low complexity region 74 85 N/A INTRINSIC
low complexity region 132 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik T G 19: 4,548,417 (GRCm39) K44T possibly damaging Het
4933402N03Rik T C 7: 130,740,823 (GRCm39) E131G probably benign Het
Angptl4 G A 17: 33,996,008 (GRCm39) P323S possibly damaging Het
Cep41 A G 6: 30,658,397 (GRCm39) S201P probably damaging Het
Cep95 A G 11: 106,697,118 (GRCm39) I257V probably damaging Het
Clca4a T C 3: 144,663,079 (GRCm39) N590S probably benign Het
Cyfip2 A G 11: 46,099,162 (GRCm39) L716P probably damaging Het
Cyp2d34 T A 15: 82,502,818 (GRCm39) Q136L probably benign Het
Def6 T C 17: 28,439,189 (GRCm39) C267R probably damaging Het
Dgat2 G A 7: 98,818,950 (GRCm39) Q69* probably null Het
Dlgap1 T A 17: 71,093,810 (GRCm39) S710R probably damaging Het
Dnah10 T C 5: 124,850,095 (GRCm39) I1539T probably benign Het
Dnah2 T A 11: 69,342,173 (GRCm39) I2932F possibly damaging Het
Enpp2 A G 15: 54,783,088 (GRCm39) S76P probably damaging Het
Esr2 T C 12: 76,214,394 (GRCm39) D19G probably damaging Het
Fam13b A T 18: 34,595,112 (GRCm39) probably null Het
Fbxw14 A T 9: 109,100,262 (GRCm39) V464D possibly damaging Het
Fcgbpl1 T A 7: 27,839,463 (GRCm39) C425* probably null Het
Gm21961 A G 15: 64,886,716 (GRCm39) probably null Het
Gpd2 C T 2: 57,228,987 (GRCm39) R264* probably null Het
Hps5 A G 7: 46,421,420 (GRCm39) V648A possibly damaging Het
Ints4 A G 7: 97,165,464 (GRCm39) T517A possibly damaging Het
Itpr3 A G 17: 27,332,814 (GRCm39) N1860S probably benign Het
Itsn2 G A 12: 4,684,546 (GRCm39) probably benign Het
Jup A G 11: 100,269,207 (GRCm39) V402A probably benign Het
Letm2 C A 8: 26,083,884 (GRCm39) E116* probably null Het
Ly6c1 T C 15: 74,917,436 (GRCm39) T71A probably benign Het
Mcm3ap G A 10: 76,342,280 (GRCm39) S1591N probably benign Het
Mier2 C T 10: 79,384,584 (GRCm39) probably null Het
Mocs2 T A 13: 114,955,882 (GRCm39) L10* probably null Het
Myo6 A G 9: 80,171,538 (GRCm39) D513G probably damaging Het
Myoz2 T C 3: 122,807,369 (GRCm39) Y147C probably damaging Het
Nin C T 12: 70,089,315 (GRCm39) V1367M probably benign Het
Nr2f6 C T 8: 71,828,675 (GRCm39) A200T probably damaging Het
Obscn C T 11: 58,947,775 (GRCm39) C4418Y probably damaging Het
Or10ak9 A G 4: 118,726,550 (GRCm39) M191V probably benign Het
Or10q12 T C 19: 13,746,144 (GRCm39) V146A probably benign Het
Or5g26 T A 2: 85,494,769 (GRCm39) H3L probably benign Het
Paxip1 C T 5: 27,953,837 (GRCm39) R953Q probably damaging Het
Pcdha1 A T 18: 37,064,454 (GRCm39) I373F possibly damaging Het
Pcdha7 G A 18: 37,108,432 (GRCm39) E486K probably benign Het
Recql5 G A 11: 115,784,780 (GRCm39) P849L probably benign Het
Recql5 G T 11: 115,784,781 (GRCm39) P849T probably benign Het
Rnf180 A T 13: 105,386,915 (GRCm39) M131K possibly damaging Het
Rplp1 A G 9: 61,821,704 (GRCm39) S3P probably benign Het
Rpp38 T A 2: 3,330,283 (GRCm39) R206S probably benign Het
Sdha G T 13: 74,487,311 (GRCm39) P159Q probably damaging Het
Shank2 T C 7: 143,959,121 (GRCm39) V199A probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Timm50 C A 7: 28,010,432 (GRCm39) A41S probably benign Het
Tmbim1 A G 1: 74,329,157 (GRCm39) probably benign Het
Tmprss11a C T 5: 86,593,664 (GRCm39) V29M possibly damaging Het
Ttc28 A T 5: 111,331,106 (GRCm39) H411L probably damaging Het
Ube4b A T 4: 149,449,861 (GRCm39) probably null Het
Zdhhc22 T A 12: 87,030,400 (GRCm39) M183L probably benign Het
Other mutations in Zfp106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Zfp106 APN 2 120,369,978 (GRCm39) missense probably benign 0.45
IGL00816:Zfp106 APN 2 120,357,329 (GRCm39) missense probably benign 0.02
IGL00822:Zfp106 APN 2 120,344,641 (GRCm39) missense probably damaging 1.00
IGL00848:Zfp106 APN 2 120,343,208 (GRCm39) missense probably damaging 1.00
IGL01293:Zfp106 APN 2 120,365,516 (GRCm39) missense possibly damaging 0.92
IGL01323:Zfp106 APN 2 120,354,945 (GRCm39) missense possibly damaging 0.74
IGL01662:Zfp106 APN 2 120,354,034 (GRCm39) missense probably benign 0.17
IGL01683:Zfp106 APN 2 120,355,036 (GRCm39) missense probably benign 0.00
IGL01809:Zfp106 APN 2 120,364,152 (GRCm39) missense probably damaging 1.00
IGL01958:Zfp106 APN 2 120,365,288 (GRCm39) missense probably benign 0.26
IGL01960:Zfp106 APN 2 120,369,803 (GRCm39) missense probably benign 0.08
IGL01960:Zfp106 APN 2 120,354,524 (GRCm39) missense probably damaging 0.99
IGL02168:Zfp106 APN 2 120,364,712 (GRCm39) missense possibly damaging 0.90
IGL02623:Zfp106 APN 2 120,376,395 (GRCm39) splice site probably null
IGL02798:Zfp106 APN 2 120,340,991 (GRCm39) missense probably damaging 1.00
IGL02828:Zfp106 APN 2 120,362,178 (GRCm39) missense possibly damaging 0.86
IGL03022:Zfp106 APN 2 120,359,120 (GRCm39) splice site probably benign
IGL03308:Zfp106 APN 2 120,354,505 (GRCm39) missense probably benign 0.00
IGL03324:Zfp106 APN 2 120,365,868 (GRCm39) missense probably benign 0.01
lepton UTSW 2 120,362,585 (GRCm39) missense probably damaging 0.98
Proton UTSW 2 120,341,015 (GRCm39) missense probably damaging 1.00
quark UTSW 2 120,365,541 (GRCm39) nonsense probably null
R0040_zfp106_031 UTSW 2 120,362,094 (GRCm39) missense probably damaging 1.00
string UTSW 2 120,364,075 (GRCm39) missense probably damaging 0.96
theory UTSW 2 120,364,158 (GRCm39) nonsense probably null
R0040:Zfp106 UTSW 2 120,362,094 (GRCm39) missense probably damaging 1.00
R0040:Zfp106 UTSW 2 120,362,094 (GRCm39) missense probably damaging 1.00
R0135:Zfp106 UTSW 2 120,350,968 (GRCm39) missense probably damaging 0.99
R0180:Zfp106 UTSW 2 120,364,356 (GRCm39) missense probably damaging 0.96
R0387:Zfp106 UTSW 2 120,358,953 (GRCm39) splice site probably null
R0558:Zfp106 UTSW 2 120,362,677 (GRCm39) missense probably damaging 1.00
R0680:Zfp106 UTSW 2 120,357,497 (GRCm39) missense probably damaging 1.00
R0729:Zfp106 UTSW 2 120,385,729 (GRCm39) missense probably damaging 0.99
R0828:Zfp106 UTSW 2 120,366,084 (GRCm39) missense probably benign 0.00
R1124:Zfp106 UTSW 2 120,365,195 (GRCm39) missense probably benign 0.00
R1147:Zfp106 UTSW 2 120,351,017 (GRCm39) missense probably damaging 1.00
R1147:Zfp106 UTSW 2 120,351,017 (GRCm39) missense probably damaging 1.00
R1226:Zfp106 UTSW 2 120,354,560 (GRCm39) missense probably damaging 1.00
R1239:Zfp106 UTSW 2 120,364,075 (GRCm39) missense probably damaging 0.96
R1634:Zfp106 UTSW 2 120,364,158 (GRCm39) nonsense probably null
R1754:Zfp106 UTSW 2 120,364,245 (GRCm39) missense probably damaging 0.98
R1754:Zfp106 UTSW 2 120,364,244 (GRCm39) missense probably damaging 0.96
R1755:Zfp106 UTSW 2 120,365,656 (GRCm39) missense probably damaging 1.00
R1763:Zfp106 UTSW 2 120,350,909 (GRCm39) missense probably benign 0.03
R1875:Zfp106 UTSW 2 120,344,096 (GRCm39) critical splice donor site probably null
R1903:Zfp106 UTSW 2 120,357,329 (GRCm39) missense probably benign 0.02
R1932:Zfp106 UTSW 2 120,362,162 (GRCm39) missense possibly damaging 0.80
R2070:Zfp106 UTSW 2 120,354,010 (GRCm39) missense probably benign 0.11
R2301:Zfp106 UTSW 2 120,366,131 (GRCm39) missense probably benign 0.04
R3429:Zfp106 UTSW 2 120,357,544 (GRCm39) missense probably benign 0.00
R3720:Zfp106 UTSW 2 120,365,080 (GRCm39) missense probably benign 0.01
R3875:Zfp106 UTSW 2 120,365,094 (GRCm39) missense probably benign 0.08
R3921:Zfp106 UTSW 2 120,364,097 (GRCm39) missense probably damaging 1.00
R3923:Zfp106 UTSW 2 120,365,337 (GRCm39) missense probably damaging 0.99
R4087:Zfp106 UTSW 2 120,357,380 (GRCm39) splice site probably null
R4678:Zfp106 UTSW 2 120,364,221 (GRCm39) missense probably damaging 1.00
R4965:Zfp106 UTSW 2 120,364,400 (GRCm39) missense probably damaging 0.98
R5011:Zfp106 UTSW 2 120,341,015 (GRCm39) missense probably damaging 1.00
R5013:Zfp106 UTSW 2 120,341,015 (GRCm39) missense probably damaging 1.00
R5151:Zfp106 UTSW 2 120,365,208 (GRCm39) missense probably benign 0.01
R5227:Zfp106 UTSW 2 120,354,449 (GRCm39) missense probably benign 0.11
R5328:Zfp106 UTSW 2 120,350,898 (GRCm39) missense possibly damaging 0.73
R5403:Zfp106 UTSW 2 120,365,262 (GRCm39) missense probably benign 0.02
R5624:Zfp106 UTSW 2 120,362,438 (GRCm39) missense probably damaging 0.99
R5686:Zfp106 UTSW 2 120,363,988 (GRCm39) splice site probably null
R5691:Zfp106 UTSW 2 120,354,952 (GRCm39) missense probably damaging 0.99
R5852:Zfp106 UTSW 2 120,346,487 (GRCm39) missense probably damaging 1.00
R6032:Zfp106 UTSW 2 120,365,874 (GRCm39) missense probably benign 0.00
R6032:Zfp106 UTSW 2 120,365,874 (GRCm39) missense probably benign 0.00
R6298:Zfp106 UTSW 2 120,353,185 (GRCm39) missense probably damaging 1.00
R6409:Zfp106 UTSW 2 120,362,585 (GRCm39) missense probably damaging 0.98
R6505:Zfp106 UTSW 2 120,364,983 (GRCm39) missense probably damaging 0.99
R6598:Zfp106 UTSW 2 120,365,541 (GRCm39) nonsense probably null
R6765:Zfp106 UTSW 2 120,369,935 (GRCm39) missense probably damaging 0.96
R7013:Zfp106 UTSW 2 120,362,113 (GRCm39) missense probably damaging 0.99
R7453:Zfp106 UTSW 2 120,376,400 (GRCm39) splice site probably null
R7453:Zfp106 UTSW 2 120,341,008 (GRCm39) missense probably damaging 1.00
R7643:Zfp106 UTSW 2 120,343,215 (GRCm39) missense probably benign 0.01
R7829:Zfp106 UTSW 2 120,354,538 (GRCm39) missense possibly damaging 0.94
R7897:Zfp106 UTSW 2 120,366,096 (GRCm39) nonsense probably null
R7909:Zfp106 UTSW 2 120,344,700 (GRCm39) missense probably damaging 1.00
R8054:Zfp106 UTSW 2 120,355,000 (GRCm39) missense possibly damaging 0.93
R8124:Zfp106 UTSW 2 120,354,812 (GRCm39) missense probably benign 0.44
R8203:Zfp106 UTSW 2 120,349,559 (GRCm39) missense probably damaging 1.00
R8350:Zfp106 UTSW 2 120,366,099 (GRCm39) missense
R8450:Zfp106 UTSW 2 120,366,099 (GRCm39) missense
R8698:Zfp106 UTSW 2 120,354,600 (GRCm39) critical splice donor site probably null
R8985:Zfp106 UTSW 2 120,366,077 (GRCm39) missense
R9015:Zfp106 UTSW 2 120,364,019 (GRCm39) missense probably damaging 1.00
R9036:Zfp106 UTSW 2 120,369,906 (GRCm39) missense probably damaging 1.00
R9142:Zfp106 UTSW 2 120,350,935 (GRCm39) missense probably damaging 1.00
R9154:Zfp106 UTSW 2 120,364,812 (GRCm39) nonsense probably null
R9175:Zfp106 UTSW 2 120,353,197 (GRCm39) missense probably damaging 1.00
R9529:Zfp106 UTSW 2 120,351,007 (GRCm39) missense probably damaging 0.97
R9572:Zfp106 UTSW 2 120,349,559 (GRCm39) missense probably damaging 1.00
R9581:Zfp106 UTSW 2 120,365,807 (GRCm39) missense
RF008:Zfp106 UTSW 2 120,355,026 (GRCm39) small deletion probably benign
RF025:Zfp106 UTSW 2 120,355,026 (GRCm39) small deletion probably benign
X0025:Zfp106 UTSW 2 120,365,297 (GRCm39) missense probably benign
Z1088:Zfp106 UTSW 2 120,360,971 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACTCAGGGCAGTATTAGG -3'
(R):5'- CTCTGGAATTCGTGTCAGAGG -3'

Sequencing Primer
(F):5'- CAGTATTAGGTGAAGGACTCTGC -3'
(R):5'- TTCTTGACAGCAGGAGCCTC -3'
Posted On 2015-04-17