Mutagenetix > Incidental Mutations

Incidental Mutation 'R0379:Pfkfb4'

30876

Institutional Source

Beutler Lab

Gene Symbol

Pfkfb4

Ensembl Gene

ENSMUSG00000025648

Gene Name

6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4

Synonyms

MMRRC Submission

038585-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0379 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108991778-109032228 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 109027742 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]

Predicted Effect

probably benign
Transcript: ENSMUST00000051873

SMART Domains

Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	249	3.2e-105	PFAM
Pfam:AAA_33	41	199	2.3e-8	PFAM
PGAM	251	398	4.39e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196249

Predicted Effect

probably benign
Transcript: ENSMUST00000198140

SMART Domains

Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	249	1.9e-105	PFAM
Pfam:AAA_33	41	198	8.5e-10	PFAM
PGAM	251	398	4.39e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198763

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199184

Predicted Effect

probably benign
Transcript: ENSMUST00000199591

SMART Domains

Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	249	1.4e-105	PFAM
Pfam:AAA_33	41	198	6.6e-10	PFAM
PGAM	251	396	4.98e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200015

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 90.9%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,785,546		probably benign	Het
4930512M02Rik	A	G	11: 11,589,365		probably benign	Het
Apba1	A	C	19: 23,934,830	N558T	probably damaging	Het
Arfgef2	T	A	2: 166,860,400		probably null	Het
Arsb	T	C	13: 93,940,627	S501P	probably benign	Het
Atp10b	A	G	11: 43,254,314	T1295A	probably benign	Het
Atp8b5	G	T	4: 43,361,898	R648L	probably damaging	Het
Bcl2a1b	T	C	9: 89,199,736	I126T	possibly damaging	Het
Brd9	T	C	13: 73,942,683		probably benign	Het
Cd93	T	C	2: 148,441,510		probably benign	Het
Chd5	A	G	4: 152,383,321	K1692R	probably benign	Het
Clcn4	T	C	7: 7,296,792	T13A	probably damaging	Het
Clec14a	A	G	12: 58,268,794	F14S	possibly damaging	Het
Clec4g	A	G	8: 3,718,440	V97A	probably benign	Het
Col24a1	G	A	3: 145,524,142	R1483K	possibly damaging	Het
Crem	A	T	18: 3,299,226	V82D	probably damaging	Het
Ctnna2	T	A	6: 77,641,440	T180S	probably benign	Het
Cybrd1	T	C	2: 71,129,755	I99T	probably benign	Het
Cyp4a32	G	A	4: 115,621,474	V468M	probably damaging	Het
Dlk1	A	G	12: 109,455,059		probably benign	Het
Dnah7b	A	T	1: 46,140,176	Y1003F	probably benign	Het
Egfem1	A	C	3: 29,668,250	E376A	possibly damaging	Het
Etl4	T	A	2: 20,807,354	I1416K	probably damaging	Het
Fbxl4	A	G	4: 22,386,106	T238A	probably benign	Het
Fer1l6	A	G	15: 58,548,338	I33M	probably benign	Het
Fndc3a	A	G	14: 72,556,609	S830P	probably damaging	Het
Fras1	C	T	5: 96,755,509	R3082*	probably null	Het
Galnt13	T	C	2: 55,060,492	V395A	possibly damaging	Het
Gm10334	T	G	6: 41,445,256		probably benign	Het
Gpd2	C	T	2: 57,345,263	T335I	probably damaging	Het
Gucy2d	C	A	7: 98,459,002		probably null	Het
Hydin	A	G	8: 110,509,127		probably benign	Het
Ints5	G	T	19: 8,897,133	V819L	possibly damaging	Het
Klhdc10	C	G	6: 30,450,670	Q292E	possibly damaging	Het
Lmbrd2	G	A	15: 9,149,479	A67T	probably benign	Het
Lrp1	T	G	10: 127,594,969	T404P	probably damaging	Het
March7	T	C	2: 60,234,126	S249P	probably benign	Het
Mcm10	T	A	2: 5,008,623	K66M	probably benign	Het
Mtmr7	C	A	8: 40,551,601	D645Y	probably damaging	Het
Muc6	T	A	7: 141,636,955	I2602F	possibly damaging	Het
Myh13	G	A	11: 67,369,295		probably benign	Het
Myo18a	G	A	11: 77,850,806	V1776I	possibly damaging	Het
Ncapg2	T	C	12: 116,443,075	L957S	probably damaging	Het
Ncoa3	T	C	2: 166,054,502	S442P	probably damaging	Het
Olfr1093	G	A	2: 86,785,735	E2K	probably benign	Het
Olfr850	T	A	9: 19,477,480	T257S	possibly damaging	Het
Olfr986	G	A	9: 40,187,433	G106D	probably damaging	Het
Pdcd6	G	T	13: 74,309,712	N113K	possibly damaging	Het
Pfkm	A	G	15: 98,126,314	H401R	probably benign	Het
Phldb2	C	A	16: 45,781,451	D754Y	probably damaging	Het
Plekhb2	T	A	1: 34,863,114	M49K	probably damaging	Het
Polrmt	A	G	10: 79,737,611	S1057P	possibly damaging	Het
Prps1l1	A	G	12: 34,985,078	N64S	probably benign	Het
Psg16	T	C	7: 17,130,658	S393P	probably benign	Het
Rundc1	C	T	11: 101,425,147	T15I	probably benign	Het
Scaf11	A	G	15: 96,431,816	L143S	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Serpinf1	T	G	11: 75,413,945	I197L	probably benign	Het
Siglec1	C	T	2: 131,074,525		probably benign	Het
Slc28a1	G	A	7: 81,138,177	V271I	probably benign	Het
Sntg1	T	C	1: 8,782,824	D34G	probably damaging	Het
Sptbn4	A	T	7: 27,359,736		probably benign	Het
Suclg1	T	C	6: 73,256,228	I51T	possibly damaging	Het
Syne1	C	T	10: 5,541,989	R9Q	probably damaging	Het
Trim47	T	A	11: 116,106,518	H470L	probably damaging	Het
Ttc41	T	A	10: 86,712,977	Y12N	possibly damaging	Het
Tubgcp2	T	C	7: 140,032,192	E69G	probably damaging	Het
Tubgcp3	G	A	8: 12,641,116	T474M	probably damaging	Het
Ubr5	A	T	15: 38,018,957	N777K	probably benign	Het
Ush2a	T	C	1: 188,451,819	L1440P	probably damaging	Het
Usp28	A	C	9: 49,024,067	D458A	possibly damaging	Het
Vcan	A	T	13: 89,703,546	D1098E	probably damaging	Het
Vmn1r73	C	T	7: 11,756,846	T197I	probably benign	Het
Vmn2r15	T	C	5: 109,286,478	S787G	probably damaging	Het
Vmn2r90	T	A	17: 17,728,139	I549N	probably damaging	Het
Vps33b	T	A	7: 80,283,414		probably null	Het
Zfp516	A	T	18: 82,987,670	K900*	probably null	Het
Zfp974	T	A	7: 27,910,932	N456I	probably damaging	Het

Other mutations in Pfkfb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01653:Pfkfb4	APN	9	108999134	missense	probably damaging	1.00
IGL01978:Pfkfb4	APN	9	109028942	missense	probably damaging	1.00
IGL02119:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02121:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02122:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02123:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02125:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02126:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02506:Pfkfb4	APN	9	109030336	missense	probably benign	0.00
IGL02881:Pfkfb4	APN	9	109007296	missense	probably null	1.00
PIT4466001:Pfkfb4	UTSW	9	108999154	missense	probably benign	0.12
PIT4472001:Pfkfb4	UTSW	9	108999154	missense	probably benign	0.12
R0087:Pfkfb4	UTSW	9	109007701	missense	probably damaging	1.00
R0101:Pfkfb4	UTSW	9	109010643	missense	probably benign	0.03
R0109:Pfkfb4	UTSW	9	108998889	missense	probably benign	0.27
R0109:Pfkfb4	UTSW	9	108998889	missense	probably benign	0.27
R0511:Pfkfb4	UTSW	9	109027757	missense	probably damaging	1.00
R1146:Pfkfb4	UTSW	9	109007726	missense	probably benign	0.00
R1146:Pfkfb4	UTSW	9	109007726	missense	probably benign	0.00
R1490:Pfkfb4	UTSW	9	109027620	missense	probably damaging	1.00
R1521:Pfkfb4	UTSW	9	109007305	missense	probably damaging	1.00
R1932:Pfkfb4	UTSW	9	108999169	missense	probably damaging	1.00
R2214:Pfkfb4	UTSW	9	109005609	missense	probably benign	0.17
R3112:Pfkfb4	UTSW	9	109025042	splice site	probably benign
R5470:Pfkfb4	UTSW	9	109027593	missense	probably damaging	1.00
R5646:Pfkfb4	UTSW	9	109008421	missense	probably damaging	1.00
R5930:Pfkfb4	UTSW	9	109030394	unclassified	probably benign
R6139:Pfkfb4	UTSW	9	109027757	missense	probably damaging	1.00
R6632:Pfkfb4	UTSW	9	109009562	splice site	probably null
R6873:Pfkfb4	UTSW	9	109010335	splice site	probably null
R6958:Pfkfb4	UTSW	9	109010547	missense	probably damaging	1.00
R7098:Pfkfb4	UTSW	9	108999154	missense	probably benign	0.05
R7131:Pfkfb4	UTSW	9	109007302	missense	probably benign	0.21
R7148:Pfkfb4	UTSW	9	109027608	missense	probably damaging	0.99
R7284:Pfkfb4	UTSW	9	109011240	missense	possibly damaging	0.88
R7903:Pfkfb4	UTSW	9	108998951	missense	probably damaging	1.00
R7973:Pfkfb4	UTSW	9	109025111	missense	probably damaging	1.00
R8506:Pfkfb4	UTSW	9	109005599	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- AACACAGCCTCTAGCGTGGTGA -3'
(R):5'- TCCCAGACAGAAAGAAGGGACTTGT -3'

Sequencing Primer
(F):5'- cagttagggtttctattgctgtg -3'
(R):5'- CTTGTGGGGCATCACAGAAC -3'

Posted On

2013-04-24