Incidental Mutation 'R0379:Pfkfb4'
ID 30876
Institutional Source Beutler Lab
Gene Symbol Pfkfb4
Ensembl Gene ENSMUSG00000025648
Gene Name 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
MMRRC Submission 038585-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0379 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 108991778-109032228 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 109027742 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]
AlphaFold Q6DTY7
Predicted Effect probably benign
Transcript: ENSMUST00000051873
SMART Domains Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648

Pfam:6PF2K 28 249 3.2e-105 PFAM
Pfam:AAA_33 41 199 2.3e-8 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196249
Predicted Effect probably benign
Transcript: ENSMUST00000198140
SMART Domains Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648

Pfam:6PF2K 28 249 1.9e-105 PFAM
Pfam:AAA_33 41 198 8.5e-10 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199184
Predicted Effect probably benign
Transcript: ENSMUST00000199591
SMART Domains Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648

Pfam:6PF2K 28 249 1.4e-105 PFAM
Pfam:AAA_33 41 198 6.6e-10 PFAM
PGAM 251 396 4.98e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200015
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,785,546 probably benign Het
4930512M02Rik A G 11: 11,589,365 probably benign Het
Apba1 A C 19: 23,934,830 N558T probably damaging Het
Arfgef2 T A 2: 166,860,400 probably null Het
Arsb T C 13: 93,940,627 S501P probably benign Het
Atp10b A G 11: 43,254,314 T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 R648L probably damaging Het
Bcl2a1b T C 9: 89,199,736 I126T possibly damaging Het
Brd9 T C 13: 73,942,683 probably benign Het
Cd93 T C 2: 148,441,510 probably benign Het
Chd5 A G 4: 152,383,321 K1692R probably benign Het
Clcn4 T C 7: 7,296,792 T13A probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Clec4g A G 8: 3,718,440 V97A probably benign Het
Col24a1 G A 3: 145,524,142 R1483K possibly damaging Het
Crem A T 18: 3,299,226 V82D probably damaging Het
Ctnna2 T A 6: 77,641,440 T180S probably benign Het
Cybrd1 T C 2: 71,129,755 I99T probably benign Het
Cyp4a32 G A 4: 115,621,474 V468M probably damaging Het
Dlk1 A G 12: 109,455,059 probably benign Het
Dnah7b A T 1: 46,140,176 Y1003F probably benign Het
Egfem1 A C 3: 29,668,250 E376A possibly damaging Het
Etl4 T A 2: 20,807,354 I1416K probably damaging Het
Fbxl4 A G 4: 22,386,106 T238A probably benign Het
Fer1l6 A G 15: 58,548,338 I33M probably benign Het
Fndc3a A G 14: 72,556,609 S830P probably damaging Het
Fras1 C T 5: 96,755,509 R3082* probably null Het
Galnt13 T C 2: 55,060,492 V395A possibly damaging Het
Gm10334 T G 6: 41,445,256 probably benign Het
Gpd2 C T 2: 57,345,263 T335I probably damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Hydin A G 8: 110,509,127 probably benign Het
Ints5 G T 19: 8,897,133 V819L possibly damaging Het
Klhdc10 C G 6: 30,450,670 Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,479 A67T probably benign Het
Lrp1 T G 10: 127,594,969 T404P probably damaging Het
March7 T C 2: 60,234,126 S249P probably benign Het
Mcm10 T A 2: 5,008,623 K66M probably benign Het
Mtmr7 C A 8: 40,551,601 D645Y probably damaging Het
Muc6 T A 7: 141,636,955 I2602F possibly damaging Het
Myh13 G A 11: 67,369,295 probably benign Het
Myo18a G A 11: 77,850,806 V1776I possibly damaging Het
Ncapg2 T C 12: 116,443,075 L957S probably damaging Het
Ncoa3 T C 2: 166,054,502 S442P probably damaging Het
Olfr1093 G A 2: 86,785,735 E2K probably benign Het
Olfr850 T A 9: 19,477,480 T257S possibly damaging Het
Olfr986 G A 9: 40,187,433 G106D probably damaging Het
Pdcd6 G T 13: 74,309,712 N113K possibly damaging Het
Pfkm A G 15: 98,126,314 H401R probably benign Het
Phldb2 C A 16: 45,781,451 D754Y probably damaging Het
Plekhb2 T A 1: 34,863,114 M49K probably damaging Het
Polrmt A G 10: 79,737,611 S1057P possibly damaging Het
Prps1l1 A G 12: 34,985,078 N64S probably benign Het
Psg16 T C 7: 17,130,658 S393P probably benign Het
Rundc1 C T 11: 101,425,147 T15I probably benign Het
Scaf11 A G 15: 96,431,816 L143S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpinf1 T G 11: 75,413,945 I197L probably benign Het
Siglec1 C T 2: 131,074,525 probably benign Het
Slc28a1 G A 7: 81,138,177 V271I probably benign Het
Sntg1 T C 1: 8,782,824 D34G probably damaging Het
Sptbn4 A T 7: 27,359,736 probably benign Het
Suclg1 T C 6: 73,256,228 I51T possibly damaging Het
Syne1 C T 10: 5,541,989 R9Q probably damaging Het
Trim47 T A 11: 116,106,518 H470L probably damaging Het
Ttc41 T A 10: 86,712,977 Y12N possibly damaging Het
Tubgcp2 T C 7: 140,032,192 E69G probably damaging Het
Tubgcp3 G A 8: 12,641,116 T474M probably damaging Het
Ubr5 A T 15: 38,018,957 N777K probably benign Het
Ush2a T C 1: 188,451,819 L1440P probably damaging Het
Usp28 A C 9: 49,024,067 D458A possibly damaging Het
Vcan A T 13: 89,703,546 D1098E probably damaging Het
Vmn1r73 C T 7: 11,756,846 T197I probably benign Het
Vmn2r15 T C 5: 109,286,478 S787G probably damaging Het
Vmn2r90 T A 17: 17,728,139 I549N probably damaging Het
Vps33b T A 7: 80,283,414 probably null Het
Zfp516 A T 18: 82,987,670 K900* probably null Het
Zfp974 T A 7: 27,910,932 N456I probably damaging Het
Other mutations in Pfkfb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Pfkfb4 APN 9 108999134 missense probably damaging 1.00
IGL01978:Pfkfb4 APN 9 109028942 missense probably damaging 1.00
IGL02119:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02121:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02122:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02123:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02125:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02126:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02506:Pfkfb4 APN 9 109030336 missense probably benign 0.00
IGL02881:Pfkfb4 APN 9 109007296 missense probably null 1.00
PIT4466001:Pfkfb4 UTSW 9 108999154 missense probably benign 0.12
PIT4472001:Pfkfb4 UTSW 9 108999154 missense probably benign 0.12
R0087:Pfkfb4 UTSW 9 109007701 missense probably damaging 1.00
R0101:Pfkfb4 UTSW 9 109010643 missense probably benign 0.03
R0109:Pfkfb4 UTSW 9 108998889 missense probably benign 0.27
R0109:Pfkfb4 UTSW 9 108998889 missense probably benign 0.27
R0511:Pfkfb4 UTSW 9 109027757 missense probably damaging 1.00
R1146:Pfkfb4 UTSW 9 109007726 missense probably benign 0.00
R1146:Pfkfb4 UTSW 9 109007726 missense probably benign 0.00
R1490:Pfkfb4 UTSW 9 109027620 missense probably damaging 1.00
R1521:Pfkfb4 UTSW 9 109007305 missense probably damaging 1.00
R1932:Pfkfb4 UTSW 9 108999169 missense probably damaging 1.00
R2214:Pfkfb4 UTSW 9 109005609 missense probably benign 0.17
R3112:Pfkfb4 UTSW 9 109025042 splice site probably benign
R5470:Pfkfb4 UTSW 9 109027593 missense probably damaging 1.00
R5646:Pfkfb4 UTSW 9 109008421 missense probably damaging 1.00
R5930:Pfkfb4 UTSW 9 109030394 unclassified probably benign
R6139:Pfkfb4 UTSW 9 109027757 missense probably damaging 1.00
R6632:Pfkfb4 UTSW 9 109009562 splice site probably null
R6873:Pfkfb4 UTSW 9 109010335 splice site probably null
R6958:Pfkfb4 UTSW 9 109010547 missense probably damaging 1.00
R7098:Pfkfb4 UTSW 9 108999154 missense probably benign 0.05
R7131:Pfkfb4 UTSW 9 109007302 missense probably benign 0.21
R7148:Pfkfb4 UTSW 9 109027608 missense probably damaging 0.99
R7284:Pfkfb4 UTSW 9 109011240 missense possibly damaging 0.88
R7903:Pfkfb4 UTSW 9 108998951 missense probably damaging 1.00
R7973:Pfkfb4 UTSW 9 109025111 missense probably damaging 1.00
R8506:Pfkfb4 UTSW 9 109005599 missense possibly damaging 0.80
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cagttagggtttctattgctgtg -3'
Posted On 2013-04-24