Incidental Mutation 'R3881:Ints4'
ID308763
Institutional Source Beutler Lab
Gene Symbol Ints4
Ensembl Gene ENSMUSG00000025133
Gene Nameintegrator complex subunit 4
Synonyms2610034N24Rik
MMRRC Submission 040795-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R3881 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location97480956-97541395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97516257 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 517 (T517A)
Ref Sequence ENSEMBL: ENSMUSP00000026126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026126]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026126
AA Change: T517A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026126
Gene: ENSMUSG00000025133
AA Change: T517A

DomainStartEndE-ValueType
Pfam:HEAT_2 153 258 9.8e-9 PFAM
Pfam:Cohesin_HEAT 179 219 7.7e-6 PFAM
low complexity region 518 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206644
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS4 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik T G 19: 4,498,389 K44T possibly damaging Het
4933402N03Rik T C 7: 131,139,094 E131G probably benign Het
9530053A07Rik T A 7: 28,140,038 C425* probably null Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Cep41 A G 6: 30,658,398 S201P probably damaging Het
Cep95 A G 11: 106,806,292 I257V probably damaging Het
Clca4a T C 3: 144,957,318 N590S probably benign Het
Cyfip2 A G 11: 46,208,335 L716P probably damaging Het
Cyp2d34 T A 15: 82,618,617 Q136L probably benign Het
Def6 T C 17: 28,220,215 C267R probably damaging Het
Dgat2 G A 7: 99,169,743 Q69* probably null Het
Dlgap1 T A 17: 70,786,815 S710R probably damaging Het
Dnah10 T C 5: 124,773,031 I1539T probably benign Het
Dnah2 T A 11: 69,451,347 I2932F possibly damaging Het
Enpp2 A G 15: 54,919,692 S76P probably damaging Het
Esr2 T C 12: 76,167,620 D19G probably damaging Het
Fam13b A T 18: 34,462,059 probably null Het
Fbxw14 A T 9: 109,271,194 V464D possibly damaging Het
Gm21961 A G 15: 65,014,867 probably null Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Hps5 A G 7: 46,771,996 V648A possibly damaging Het
Itpr3 A G 17: 27,113,840 N1860S probably benign Het
Itsn2 G A 12: 4,634,546 probably benign Het
Jup A G 11: 100,378,381 V402A probably benign Het
Letm2 C A 8: 25,593,868 E116* probably null Het
Ly6c1 T C 15: 75,045,587 T71A probably benign Het
Mcm3ap G A 10: 76,506,446 S1591N probably benign Het
Mier2 C T 10: 79,548,750 probably null Het
Mocs2 T A 13: 114,819,346 L10* probably null Het
Myo6 A G 9: 80,264,256 D513G probably damaging Het
Myoz2 T C 3: 123,013,720 Y147C probably damaging Het
Nin C T 12: 70,042,541 V1367M probably benign Het
Nr2f6 C T 8: 71,376,031 A200T probably damaging Het
Obscn C T 11: 59,056,949 C4418Y probably damaging Het
Olfr1331 A G 4: 118,869,353 M191V probably benign Het
Olfr1495 T C 19: 13,768,780 V146A probably benign Het
Olfr154 T A 2: 85,664,425 H3L probably benign Het
Paxip1 C T 5: 27,748,839 R953Q probably damaging Het
Pcdha1 A T 18: 36,931,401 I373F possibly damaging Het
Pcdha7 G A 18: 36,975,379 E486K probably benign Het
Recql5 G A 11: 115,893,954 P849L probably benign Het
Recql5 G T 11: 115,893,955 P849T probably benign Het
Rnf180 A T 13: 105,250,407 M131K possibly damaging Het
Rplp1 A G 9: 61,914,422 S3P probably benign Het
Rpp38 T A 2: 3,329,246 R206S probably benign Het
Sdha G T 13: 74,339,192 P159Q probably damaging Het
Shank2 T C 7: 144,405,384 V199A probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Timm50 C A 7: 28,311,007 A41S probably benign Het
Tmbim1 A G 1: 74,289,998 probably benign Het
Tmprss11a C T 5: 86,445,805 V29M possibly damaging Het
Ttc28 A T 5: 111,183,240 H411L probably damaging Het
Ube4b A T 4: 149,365,404 probably null Het
Zdhhc22 T A 12: 86,983,626 M183L probably benign Het
Zfp106 A G 2: 120,532,149 S830P probably benign Het
Other mutations in Ints4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Ints4 APN 7 97535205 missense probably damaging 1.00
IGL01736:Ints4 APN 7 97526642 missense probably benign 0.01
IGL01862:Ints4 APN 7 97541153 missense probably damaging 1.00
IGL02277:Ints4 APN 7 97487458 missense probably damaging 1.00
IGL02396:Ints4 APN 7 97537900 missense possibly damaging 0.64
IGL02661:Ints4 APN 7 97495705 missense probably benign
IGL02750:Ints4 APN 7 97517757 critical splice donor site probably null
IGL03108:Ints4 APN 7 97490930 critical splice acceptor site probably null
R0332:Ints4 UTSW 7 97517718 missense probably damaging 1.00
R0449:Ints4 UTSW 7 97529223 missense probably damaging 0.97
R1065:Ints4 UTSW 7 97507892 critical splice donor site probably null
R1722:Ints4 UTSW 7 97513579 missense probably benign 0.24
R2060:Ints4 UTSW 7 97501763 missense possibly damaging 0.93
R2211:Ints4 UTSW 7 97509750 missense possibly damaging 0.63
R3731:Ints4 UTSW 7 97506101 missense probably benign 0.18
R4089:Ints4 UTSW 7 97529255 nonsense probably null
R4192:Ints4 UTSW 7 97507733 missense probably damaging 1.00
R4479:Ints4 UTSW 7 97484971 missense probably damaging 1.00
R4980:Ints4 UTSW 7 97501850 critical splice donor site probably null
R5029:Ints4 UTSW 7 97509774 missense probably benign 0.06
R5306:Ints4 UTSW 7 97509678 missense probably damaging 1.00
R6160:Ints4 UTSW 7 97509583 splice site probably null
R6317:Ints4 UTSW 7 97529218 nonsense probably null
R6961:Ints4 UTSW 7 97541190 makesense probably null
R7026:Ints4 UTSW 7 97519154 missense possibly damaging 0.50
R7156:Ints4 UTSW 7 97535286 critical splice donor site probably null
R7205:Ints4 UTSW 7 97535226 nonsense probably null
R7234:Ints4 UTSW 7 97530300 missense probably benign 0.00
R7418:Ints4 UTSW 7 97490972 missense probably benign 0.03
R7423:Ints4 UTSW 7 97507719 missense probably damaging 1.00
R7462:Ints4 UTSW 7 97506128 missense probably benign 0.11
R7658:Ints4 UTSW 7 97529253 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GATAGCCATTTGCAGTGAACTAG -3'
(R):5'- GTCCTTCTGACATACTACAGCAAC -3'

Sequencing Primer
(F):5'- CCATTTGCAGTGAACTAGCCGAG -3'
(R):5'- TTCTGACATACTACAGCAACAAAAGG -3'
Posted On2015-04-17