Mutagenetix > Incidental Mutations

Incidental Mutation 'R0379:Syne1'

30877

Institutional Source

Beutler Lab

Gene Symbol

Syne1

Ensembl Gene

ENSMUSG00000096054

Gene Name

spectrin repeat containing, nuclear envelope 1

Synonyms

A330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik

MMRRC Submission

038585-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0379 (G1)

Quality Score

176

Status

Validated

Chromosome

Chromosomal Location

5020917-5551482 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 5541989 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 9 (R9Q)

Ref Sequence

ENSEMBL: ENSMUSP00000150262 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041639] [ENSMUST00000214945] [ENSMUST00000215295]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041639
AA Change: R9Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000039440
Gene: ENSMUSG00000096054
AA Change: R9Q

Domain	Start	End	E-Value	Type
CH	29	139	4.55e-14	SMART
low complexity region	145	167	N/A	INTRINSIC
CH	187	285	9.67e-18	SMART
coiled coil region	425	452	N/A	INTRINSIC
Blast:SPEC	493	599	2e-28	BLAST
Blast:SPEC	606	695	7e-40	BLAST
Blast:SPEC	701	815	1e-32	BLAST
Blast:SPEC	815	913	4e-41	BLAST
Blast:SPEC	920	1013	9e-53	BLAST
Blast:SPEC	1117	1219	2e-60	BLAST
coiled coil region	1267	1329	N/A	INTRINSIC
low complexity region	1349	1368	N/A	INTRINSIC
coiled coil region	1399	1427	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000214945
AA Change: R9Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000215295
AA Change: R9Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.1830

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 90.9%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,785,546		probably benign	Het
4930512M02Rik	A	G	11: 11,589,365		probably benign	Het
Apba1	A	C	19: 23,934,830	N558T	probably damaging	Het
Arfgef2	T	A	2: 166,860,400		probably null	Het
Arsb	T	C	13: 93,940,627	S501P	probably benign	Het
Atp10b	A	G	11: 43,254,314	T1295A	probably benign	Het
Atp8b5	G	T	4: 43,361,898	R648L	probably damaging	Het
Bcl2a1b	T	C	9: 89,199,736	I126T	possibly damaging	Het
Brd9	T	C	13: 73,942,683		probably benign	Het
Cd93	T	C	2: 148,441,510		probably benign	Het
Chd5	A	G	4: 152,383,321	K1692R	probably benign	Het
Clcn4	T	C	7: 7,296,792	T13A	probably damaging	Het
Clec14a	A	G	12: 58,268,794	F14S	possibly damaging	Het
Clec4g	A	G	8: 3,718,440	V97A	probably benign	Het
Col24a1	G	A	3: 145,524,142	R1483K	possibly damaging	Het
Crem	A	T	18: 3,299,226	V82D	probably damaging	Het
Ctnna2	T	A	6: 77,641,440	T180S	probably benign	Het
Cybrd1	T	C	2: 71,129,755	I99T	probably benign	Het
Cyp4a32	G	A	4: 115,621,474	V468M	probably damaging	Het
Dlk1	A	G	12: 109,455,059		probably benign	Het
Dnah7b	A	T	1: 46,140,176	Y1003F	probably benign	Het
Egfem1	A	C	3: 29,668,250	E376A	possibly damaging	Het
Etl4	T	A	2: 20,807,354	I1416K	probably damaging	Het
Fbxl4	A	G	4: 22,386,106	T238A	probably benign	Het
Fer1l6	A	G	15: 58,548,338	I33M	probably benign	Het
Fndc3a	A	G	14: 72,556,609	S830P	probably damaging	Het
Fras1	C	T	5: 96,755,509	R3082*	probably null	Het
Galnt13	T	C	2: 55,060,492	V395A	possibly damaging	Het
Gm10334	T	G	6: 41,445,256		probably benign	Het
Gpd2	C	T	2: 57,345,263	T335I	probably damaging	Het
Gucy2d	C	A	7: 98,459,002		probably null	Het
Hydin	A	G	8: 110,509,127		probably benign	Het
Ints5	G	T	19: 8,897,133	V819L	possibly damaging	Het
Klhdc10	C	G	6: 30,450,670	Q292E	possibly damaging	Het
Lmbrd2	G	A	15: 9,149,479	A67T	probably benign	Het
Lrp1	T	G	10: 127,594,969	T404P	probably damaging	Het
March7	T	C	2: 60,234,126	S249P	probably benign	Het
Mcm10	T	A	2: 5,008,623	K66M	probably benign	Het
Mtmr7	C	A	8: 40,551,601	D645Y	probably damaging	Het
Muc6	T	A	7: 141,636,955	I2602F	possibly damaging	Het
Myh13	G	A	11: 67,369,295		probably benign	Het
Myo18a	G	A	11: 77,850,806	V1776I	possibly damaging	Het
Ncapg2	T	C	12: 116,443,075	L957S	probably damaging	Het
Ncoa3	T	C	2: 166,054,502	S442P	probably damaging	Het
Olfr1093	G	A	2: 86,785,735	E2K	probably benign	Het
Olfr850	T	A	9: 19,477,480	T257S	possibly damaging	Het
Olfr986	G	A	9: 40,187,433	G106D	probably damaging	Het
Pdcd6	G	T	13: 74,309,712	N113K	possibly damaging	Het
Pfkfb4	C	T	9: 109,027,742		probably benign	Het
Pfkm	A	G	15: 98,126,314	H401R	probably benign	Het
Phldb2	C	A	16: 45,781,451	D754Y	probably damaging	Het
Plekhb2	T	A	1: 34,863,114	M49K	probably damaging	Het
Polrmt	A	G	10: 79,737,611	S1057P	possibly damaging	Het
Prps1l1	A	G	12: 34,985,078	N64S	probably benign	Het
Psg16	T	C	7: 17,130,658	S393P	probably benign	Het
Rundc1	C	T	11: 101,425,147	T15I	probably benign	Het
Scaf11	A	G	15: 96,431,816	L143S	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Serpinf1	T	G	11: 75,413,945	I197L	probably benign	Het
Siglec1	C	T	2: 131,074,525		probably benign	Het
Slc28a1	G	A	7: 81,138,177	V271I	probably benign	Het
Sntg1	T	C	1: 8,782,824	D34G	probably damaging	Het
Sptbn4	A	T	7: 27,359,736		probably benign	Het
Suclg1	T	C	6: 73,256,228	I51T	possibly damaging	Het
Trim47	T	A	11: 116,106,518	H470L	probably damaging	Het
Ttc41	T	A	10: 86,712,977	Y12N	possibly damaging	Het
Tubgcp2	T	C	7: 140,032,192	E69G	probably damaging	Het
Tubgcp3	G	A	8: 12,641,116	T474M	probably damaging	Het
Ubr5	A	T	15: 38,018,957	N777K	probably benign	Het
Ush2a	T	C	1: 188,451,819	L1440P	probably damaging	Het
Usp28	A	C	9: 49,024,067	D458A	possibly damaging	Het
Vcan	A	T	13: 89,703,546	D1098E	probably damaging	Het
Vmn1r73	C	T	7: 11,756,846	T197I	probably benign	Het
Vmn2r15	T	C	5: 109,286,478	S787G	probably damaging	Het
Vmn2r90	T	A	17: 17,728,139	I549N	probably damaging	Het
Vps33b	T	A	7: 80,283,414		probably null	Het
Zfp516	A	T	18: 82,987,670	K900*	probably null	Het
Zfp974	T	A	7: 27,910,932	N456I	probably damaging	Het

Other mutations in Syne1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00684:Syne1	APN	10	5342167	synonymous	probably benign
IGL00725:Syne1	APN	10	5344922	missense	possibly damaging	0.48
IGL00799:Syne1	APN	10	5347878	missense	probably benign	0.00
IGL01087:Syne1	APN	10	5425708	missense	probably damaging	1.00
IGL01123:Syne1	APN	10	5344921	nonsense	probably null
IGL01147:Syne1	APN	10	5052691	nonsense	probably null
IGL01150:Syne1	APN	10	5443154	missense	probably damaging	1.00
IGL01154:Syne1	APN	10	5360848	missense	probably damaging	1.00
IGL01727:Syne1	APN	10	5047842	missense	probably damaging	0.99
IGL01761:Syne1	APN	10	5405456	missense	probably damaging	1.00
IGL01793:Syne1	APN	10	5352191	missense	possibly damaging	0.67
IGL01961:Syne1	APN	10	5043723	missense	possibly damaging	0.94
IGL01975:Syne1	APN	10	5068908	intron	probably benign
IGL02152:Syne1	APN	10	5424382	missense	probably damaging	1.00
IGL02423:Syne1	APN	10	5368295	missense	probably benign	0.00
IGL02457:Syne1	APN	10	5342167	missense	probably damaging	1.00
IGL02543:Syne1	APN	10	5043618	missense	probably damaging	0.97
IGL02836:Syne1	APN	10	5409875	splice site	probably benign
IGL03141:Syne1	APN	10	5424261	missense	probably damaging	1.00
FR4548:Syne1	UTSW	10	5032969	missense	probably benign	0.09
IGL02799:Syne1	UTSW	10	5359059	missense	probably damaging	1.00
PIT4305001:Syne1	UTSW	10	5333023	missense	probably damaging	1.00
PIT4687001:Syne1	UTSW	10	5358390	missense	possibly damaging	0.87
R0004:Syne1	UTSW	10	5443132	splice site	probably benign
R0110:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0165:Syne1	UTSW	10	5033096	missense	probably benign	0.28
R0194:Syne1	UTSW	10	5424311	missense	probably benign
R0311:Syne1	UTSW	10	5348943	missense	possibly damaging	0.92
R0328:Syne1	UTSW	10	5348945	missense	possibly damaging	0.62
R0387:Syne1	UTSW	10	5351029	missense	probably benign
R0452:Syne1	UTSW	10	5405435	missense	probably damaging	0.98
R0456:Syne1	UTSW	10	5342252	missense	probably benign	0.04
R0457:Syne1	UTSW	10	5022041	missense	probably damaging	1.00
R0469:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0510:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0533:Syne1	UTSW	10	5358438	missense	probably benign	0.00
R0617:Syne1	UTSW	10	5350933	missense	probably damaging	1.00
R0690:Syne1	UTSW	10	5033138	splice site	probably benign
R0964:Syne1	UTSW	10	5043652	missense	possibly damaging	0.95
R1133:Syne1	UTSW	10	5349044	missense	possibly damaging	0.77
R1327:Syne1	UTSW	10	5048925	splice site	probably benign
R1339:Syne1	UTSW	10	5367571	missense	probably damaging	1.00
R1531:Syne1	UTSW	10	5347875	nonsense	probably null
R1558:Syne1	UTSW	10	5349280	nonsense	probably null
R1633:Syne1	UTSW	10	5349388	missense	probably damaging	1.00
R1642:Syne1	UTSW	10	5348694	missense	possibly damaging	0.94
R1658:Syne1	UTSW	10	5367616	missense	probably benign	0.03
R1753:Syne1	UTSW	10	5367621	missense	probably benign	0.28
R1759:Syne1	UTSW	10	5349369	missense	probably damaging	1.00
R1792:Syne1	UTSW	10	5040975	missense	probably damaging	1.00
R2076:Syne1	UTSW	10	5040897	missense	probably damaging	0.99
R2079:Syne1	UTSW	10	5361502	missense	probably benign	0.01
R2102:Syne1	UTSW	10	5056514	missense	probably damaging	1.00
R2233:Syne1	UTSW	10	5041484	missense	probably benign	0.01
R2305:Syne1	UTSW	10	5047573	missense	probably damaging	0.97
R3435:Syne1	UTSW	10	5348565	missense	probably damaging	1.00
R3749:Syne1	UTSW	10	5052267	splice site	probably benign
R3876:Syne1	UTSW	10	5052345	missense	possibly damaging	0.57
R3895:Syne1	UTSW	10	5405456	missense	probably damaging	0.98
R3974:Syne1	UTSW	10	5043630	missense	probably benign	0.06
R4042:Syne1	UTSW	10	5041584	missense	probably benign	0.21
R4120:Syne1	UTSW	10	5409798	missense	probably damaging	1.00
R4201:Syne1	UTSW	10	5347870	missense	probably benign
R4364:Syne1	UTSW	10	5353987	missense	probably damaging	0.96
R4498:Syne1	UTSW	10	5031768	missense	probably benign	0.00
R4767:Syne1	UTSW	10	5344866	nonsense	probably null
R4804:Syne1	UTSW	10	5349310	missense	possibly damaging	0.95
R4917:Syne1	UTSW	10	5057909	missense	probably damaging	1.00
R4930:Syne1	UTSW	10	5052777	missense	probably damaging	0.99
R5081:Syne1	UTSW	10	5047767	missense	probably benign	0.04
R5089:Syne1	UTSW	10	5405444	nonsense	probably null
R5174:Syne1	UTSW	10	5041490	missense	probably damaging	0.99
R5205:Syne1	UTSW	10	5052295	missense	probably benign	0.05
R5303:Syne1	UTSW	10	5420464	missense	probably benign	0.00
R5384:Syne1	UTSW	10	5041494	missense	probably benign	0.00
R5385:Syne1	UTSW	10	5041494	missense	probably benign	0.00
R5392:Syne1	UTSW	10	5348661	missense	probably damaging	1.00
R5442:Syne1	UTSW	10	5343473	missense	probably benign	0.09
R5750:Syne1	UTSW	10	5339209	missense	probably benign	0.01
R5935:Syne1	UTSW	10	5360706	splice site	probably null
R6015:Syne1	UTSW	10	5346819	critical splice donor site	probably null
R6023:Syne1	UTSW	10	5443223	missense	probably benign	0.09
R6049:Syne1	UTSW	10	5347926	missense	possibly damaging	0.79
R6084:Syne1	UTSW	10	5348994	missense	probably damaging	1.00
R6145:Syne1	UTSW	10	5052750	missense	probably damaging	1.00
R6164:Syne1	UTSW	10	5061429	missense	probably damaging	1.00
R6165:Syne1	UTSW	10	5425678	missense	probably damaging	1.00
R6198:Syne1	UTSW	10	5302269	missense	probably damaging	0.99
R6217:Syne1	UTSW	10	5293761	missense	probably benign	0.00
R6247:Syne1	UTSW	10	5349071	missense	probably damaging	0.98
R6271:Syne1	UTSW	10	5234652	missense	probably damaging	1.00
R6338:Syne1	UTSW	10	5255475	missense	probably benign	0.00
R6344:Syne1	UTSW	10	5022212	missense	probably benign	0.08
R6434:Syne1	UTSW	10	5318422	missense	probably benign	0.01
R6476:Syne1	UTSW	10	5154531	missense	possibly damaging	0.88
R6479:Syne1	UTSW	10	5231679	nonsense	probably null
R6479:Syne1	UTSW	10	5456826	missense	probably damaging	1.00
R6546:Syne1	UTSW	10	5218645	nonsense	probably null
R6578:Syne1	UTSW	10	5405454	nonsense	probably null
R6611:Syne1	UTSW	10	5045273	missense	probably benign	0.01
R6615:Syne1	UTSW	10	5301340	missense	probably damaging	0.98
R6632:Syne1	UTSW	10	5215667	critical splice donor site	probably null
R6662:Syne1	UTSW	10	5128416	missense	probably damaging	1.00
R6677:Syne1	UTSW	10	5040942	missense	possibly damaging	0.82
R6764:Syne1	UTSW	10	5229011	nonsense	probably null
R6765:Syne1	UTSW	10	5143285	splice site	probably null
R6778:Syne1	UTSW	10	5102406	missense	probably damaging	0.97
R6851:Syne1	UTSW	10	5262703	nonsense	probably null
R6878:Syne1	UTSW	10	5420388	missense	possibly damaging	0.78
R6883:Syne1	UTSW	10	5231704	nonsense	probably null
R6910:Syne1	UTSW	10	5048887	missense	probably benign	0.01
R6916:Syne1	UTSW	10	5227912	missense	probably benign	0.00
R6925:Syne1	UTSW	10	5126682	missense	probably benign	0.00
R6943:Syne1	UTSW	10	5083940	missense	probably benign
R6947:Syne1	UTSW	10	5175789	missense	probably damaging	1.00
R6965:Syne1	UTSW	10	5229120	missense	possibly damaging	0.66
R6968:Syne1	UTSW	10	5117041	missense	probably benign	0.09
R7043:Syne1	UTSW	10	5072193	missense	possibly damaging	0.77
R7059:Syne1	UTSW	10	5346859	missense	probably damaging	1.00
R7067:Syne1	UTSW	10	5234586	missense	probably damaging	1.00
R7087:Syne1	UTSW	10	5542024	start gained	probably benign
R7099:Syne1	UTSW	10	5123744	missense	probably benign	0.43
R7107:Syne1	UTSW	10	5132078	missense	probably damaging	1.00
R7120:Syne1	UTSW	10	5293971	missense	probably benign
R7127:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7128:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7131:Syne1	UTSW	10	5228221	missense	probably damaging	1.00
R7132:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7133:Syne1	UTSW	10	5231592	missense	probably damaging	1.00
R7135:Syne1	UTSW	10	5233409	missense	probably benign	0.01
R7147:Syne1	UTSW	10	5249340	missense	probably damaging	1.00
R7158:Syne1	UTSW	10	5057931	missense	probably damaging	1.00
R7189:Syne1	UTSW	10	5424295	missense	probably benign	0.03
R7193:Syne1	UTSW	10	5233406	missense	probably damaging	1.00
R7194:Syne1	UTSW	10	5110859	missense	probably damaging	1.00
R7233:Syne1	UTSW	10	5302160	missense	probably damaging	1.00
R7255:Syne1	UTSW	10	5333446	missense	probably damaging	0.98
R7267:Syne1	UTSW	10	5228218	missense	probably damaging	1.00
R7294:Syne1	UTSW	10	5097483	critical splice donor site	probably null
R7303:Syne1	UTSW	10	5256805	missense	probably benign	0.04
R7313:Syne1	UTSW	10	5047635	missense	probably damaging	1.00
R7330:Syne1	UTSW	10	5128434	missense	probably benign	0.00
R7334:Syne1	UTSW	10	5057886	missense	probably damaging	1.00
R7363:Syne1	UTSW	10	5140970	missense	possibly damaging	0.45
R7400:Syne1	UTSW	10	5218580	missense	probably benign	0.12
R7425:Syne1	UTSW	10	5425760	missense	probably damaging	1.00
R7427:Syne1	UTSW	10	5273718	missense	probably damaging	0.98
R7446:Syne1	UTSW	10	5222266	missense	probably benign	0.00
R7462:Syne1	UTSW	10	5052793	missense	possibly damaging	0.87
R7502:Syne1	UTSW	10	5333446	missense	probably damaging	0.98
R7525:Syne1	UTSW	10	5185559	critical splice acceptor site	probably null
R7529:Syne1	UTSW	10	5424382	missense	probably damaging	1.00
R7577:Syne1	UTSW	10	5124820	missense	probably damaging	1.00
R7579:Syne1	UTSW	10	5349324	missense	probably damaging	1.00
R7594:Syne1	UTSW	10	5215190	critical splice donor site	probably null
R7646:Syne1	UTSW	10	5172949	missense	probably damaging	1.00
R7651:Syne1	UTSW	10	5205074	missense	probably benign	0.38
R7651:Syne1	UTSW	10	5343416	missense	probably damaging	1.00
R7669:Syne1	UTSW	10	5061531	missense	probably damaging	1.00
R7672:Syne1	UTSW	10	5218527	missense	probably benign	0.02
R7682:Syne1	UTSW	10	5162461	missense	probably benign
R7702:Syne1	UTSW	10	5245835	missense	probably damaging	1.00
R7767:Syne1	UTSW	10	5333560	missense	possibly damaging	0.60
R7767:Syne1	UTSW	10	5333632	missense	possibly damaging	0.49
R7829:Syne1	UTSW	10	5342293	missense	probably damaging	0.96
R7840:Syne1	UTSW	10	5132078	missense	probably damaging	1.00
R7859:Syne1	UTSW	10	5157683	missense	possibly damaging	0.80
R7899:Syne1	UTSW	10	5227956	nonsense	probably null
R7918:Syne1	UTSW	10	5359078	missense	possibly damaging	0.50
R7923:Syne1	UTSW	10	5264738	missense	probably damaging	1.00
R7946:Syne1	UTSW	10	5250919	missense	possibly damaging	0.92
R7966:Syne1	UTSW	10	5116965	critical splice donor site	probably null
R7975:Syne1	UTSW	10	5031786	missense	probably benign	0.00
R7981:Syne1	UTSW	10	5229248	missense	probably benign	0.04
R8053:Syne1	UTSW	10	5052658	nonsense	probably null
R8054:Syne1	UTSW	10	5270970	missense	probably benign	0.22
R8062:Syne1	UTSW	10	5185394	critical splice donor site	probably null
R8085:Syne1	UTSW	10	5228021	missense	possibly damaging	0.78
R8087:Syne1	UTSW	10	5333034	missense	probably benign
R8094:Syne1	UTSW	10	5117031	missense	probably damaging	0.98
R8310:Syne1	UTSW	10	5347829	missense	probably benign
R8325:Syne1	UTSW	10	5146257	missense	probably benign	0.15
R8342:Syne1	UTSW	10	5108622	missense	probably benign	0.18
R8353:Syne1	UTSW	10	5350983	missense	probably damaging	1.00
R8376:Syne1	UTSW	10	5043615	missense	probably benign	0.09
R8398:Syne1	UTSW	10	5124923	missense	probably damaging	1.00
R8434:Syne1	UTSW	10	5123057	missense	probably benign	0.00
R8436:Syne1	UTSW	10	5228659	missense	probably benign	0.26
R8459:Syne1	UTSW	10	5424277	nonsense	probably null
R8461:Syne1	UTSW	10	5061463	missense	probably benign	0.34
R8496:Syne1	UTSW	10	5228896	missense	probably damaging	0.99
R8496:Syne1	UTSW	10	5318441	missense	probably damaging	0.99
RF010:Syne1	UTSW	10	5246386	missense	possibly damaging	0.89
RF015:Syne1	UTSW	10	5302248	missense	probably benign	0.01
RF023:Syne1	UTSW	10	5255482	missense	probably damaging	1.00
X0017:Syne1	UTSW	10	5346917	missense	probably damaging	1.00
X0025:Syne1	UTSW	10	5358973	nonsense	probably null
X0063:Syne1	UTSW	10	5052354	missense	probably damaging	1.00
Z1176:Syne1	UTSW	10	5248364	missense	probably damaging	0.96
Z1176:Syne1	UTSW	10	5259280	missense	probably benign
Z1176:Syne1	UTSW	10	5330251	missense	probably benign	0.10
Z1177:Syne1	UTSW	10	5143230	missense	possibly damaging	0.78
Z1177:Syne1	UTSW	10	5259349	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGACCCTATCAGGACAGTAAAGCAG -3'
(R):5'- GTTCACAGGAATTACAGCGTCTCCTC -3'

Sequencing Primer
(F):5'- GCTGTACCTTGTCACATGAAG -3'
(R):5'- TCACTGATCACCACGAGTGC -3'

Posted On

2013-04-24