Incidental Mutation 'R3881:Mier2'
ID308773
Institutional Source Beutler Lab
Gene Symbol Mier2
Ensembl Gene ENSMUSG00000042570
Gene NameMIER family member 2
Synonyms
MMRRC Submission 040795-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R3881 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79540245-79555199 bp(-) (GRCm38)
Type of Mutationunclassified (808 bp from exon)
DNA Base Change (assembly) C to T at 79548750 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062855] [ENSMUST00000062855] [ENSMUST00000164895] [ENSMUST00000165028] [ENSMUST00000165028] [ENSMUST00000165778] [ENSMUST00000165866] [ENSMUST00000167183] [ENSMUST00000167689] [ENSMUST00000170018]
Predicted Effect probably null
Transcript: ENSMUST00000062855
SMART Domains Protein: ENSMUSP00000059864
Gene: ENSMUSG00000042570

DomainStartEndE-ValueType
ELM2 194 246 1.46e-9 SMART
SANT 295 344 6.01e-8 SMART
low complexity region 441 458 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000062855
SMART Domains Protein: ENSMUSP00000059864
Gene: ENSMUSG00000042570

DomainStartEndE-ValueType
ELM2 194 246 1.46e-9 SMART
SANT 295 344 6.01e-8 SMART
low complexity region 441 458 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164895
Predicted Effect probably null
Transcript: ENSMUST00000165028
SMART Domains Protein: ENSMUSP00000127387
Gene: ENSMUSG00000042570

DomainStartEndE-ValueType
ELM2 196 248 1.46e-9 SMART
SANT 297 346 6.01e-8 SMART
low complexity region 443 460 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165028
SMART Domains Protein: ENSMUSP00000127387
Gene: ENSMUSG00000042570

DomainStartEndE-ValueType
ELM2 196 248 1.46e-9 SMART
SANT 297 346 6.01e-8 SMART
low complexity region 443 460 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165778
Predicted Effect probably null
Transcript: ENSMUST00000165866
SMART Domains Protein: ENSMUSP00000127332
Gene: ENSMUSG00000042570

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 42 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167183
Predicted Effect probably null
Transcript: ENSMUST00000167689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167760
Predicted Effect probably null
Transcript: ENSMUST00000170018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170950
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik T G 19: 4,498,389 K44T possibly damaging Het
4933402N03Rik T C 7: 131,139,094 E131G probably benign Het
9530053A07Rik T A 7: 28,140,038 C425* probably null Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Cep41 A G 6: 30,658,398 S201P probably damaging Het
Cep95 A G 11: 106,806,292 I257V probably damaging Het
Clca4a T C 3: 144,957,318 N590S probably benign Het
Cyfip2 A G 11: 46,208,335 L716P probably damaging Het
Cyp2d34 T A 15: 82,618,617 Q136L probably benign Het
Def6 T C 17: 28,220,215 C267R probably damaging Het
Dgat2 G A 7: 99,169,743 Q69* probably null Het
Dlgap1 T A 17: 70,786,815 S710R probably damaging Het
Dnah10 T C 5: 124,773,031 I1539T probably benign Het
Dnah2 T A 11: 69,451,347 I2932F possibly damaging Het
Enpp2 A G 15: 54,919,692 S76P probably damaging Het
Esr2 T C 12: 76,167,620 D19G probably damaging Het
Fam13b A T 18: 34,462,059 probably null Het
Fbxw14 A T 9: 109,271,194 V464D possibly damaging Het
Gm21961 A G 15: 65,014,867 probably null Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Hps5 A G 7: 46,771,996 V648A possibly damaging Het
Ints4 A G 7: 97,516,257 T517A possibly damaging Het
Itpr3 A G 17: 27,113,840 N1860S probably benign Het
Itsn2 G A 12: 4,634,546 probably benign Het
Jup A G 11: 100,378,381 V402A probably benign Het
Letm2 C A 8: 25,593,868 E116* probably null Het
Ly6c1 T C 15: 75,045,587 T71A probably benign Het
Mcm3ap G A 10: 76,506,446 S1591N probably benign Het
Mocs2 T A 13: 114,819,346 L10* probably null Het
Myo6 A G 9: 80,264,256 D513G probably damaging Het
Myoz2 T C 3: 123,013,720 Y147C probably damaging Het
Nin C T 12: 70,042,541 V1367M probably benign Het
Nr2f6 C T 8: 71,376,031 A200T probably damaging Het
Obscn C T 11: 59,056,949 C4418Y probably damaging Het
Olfr1331 A G 4: 118,869,353 M191V probably benign Het
Olfr1495 T C 19: 13,768,780 V146A probably benign Het
Olfr154 T A 2: 85,664,425 H3L probably benign Het
Paxip1 C T 5: 27,748,839 R953Q probably damaging Het
Pcdha1 A T 18: 36,931,401 I373F possibly damaging Het
Pcdha7 G A 18: 36,975,379 E486K probably benign Het
Recql5 G A 11: 115,893,954 P849L probably benign Het
Recql5 G T 11: 115,893,955 P849T probably benign Het
Rnf180 A T 13: 105,250,407 M131K possibly damaging Het
Rplp1 A G 9: 61,914,422 S3P probably benign Het
Rpp38 T A 2: 3,329,246 R206S probably benign Het
Sdha G T 13: 74,339,192 P159Q probably damaging Het
Shank2 T C 7: 144,405,384 V199A probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Timm50 C A 7: 28,311,007 A41S probably benign Het
Tmbim1 A G 1: 74,289,998 probably benign Het
Tmprss11a C T 5: 86,445,805 V29M possibly damaging Het
Ttc28 A T 5: 111,183,240 H411L probably damaging Het
Ube4b A T 4: 149,365,404 probably null Het
Zdhhc22 T A 12: 86,983,626 M183L probably benign Het
Zfp106 A G 2: 120,532,149 S830P probably benign Het
Other mutations in Mier2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Mier2 APN 10 79541180 makesense probably null
IGL01761:Mier2 APN 10 79548352 critical splice donor site probably null
IGL01845:Mier2 APN 10 79549584 missense possibly damaging 0.69
IGL02336:Mier2 APN 10 79548350 unclassified probably benign
IGL02882:Mier2 APN 10 79547721 missense probably damaging 1.00
IGL02902:Mier2 APN 10 79549622 missense probably damaging 1.00
R0325:Mier2 UTSW 10 79542596 critical splice donor site probably null
R0972:Mier2 UTSW 10 79544621 unclassified probably benign
R1326:Mier2 UTSW 10 79544709 missense probably damaging 1.00
R1333:Mier2 UTSW 10 79545157 missense probably benign 0.03
R1721:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R1867:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R1868:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R2015:Mier2 UTSW 10 79541202 splice site probably null
R2273:Mier2 UTSW 10 79544534 missense probably damaging 1.00
R2274:Mier2 UTSW 10 79544534 missense probably damaging 1.00
R3729:Mier2 UTSW 10 79545042 unclassified probably benign
R3874:Mier2 UTSW 10 79541797 missense possibly damaging 0.49
R4755:Mier2 UTSW 10 79549197 missense probably damaging 1.00
R4758:Mier2 UTSW 10 79550348 missense probably damaging 1.00
R5070:Mier2 UTSW 10 79549577 missense probably benign 0.03
R6282:Mier2 UTSW 10 79544742 missense probably damaging 1.00
R6785:Mier2 UTSW 10 79544713 missense probably damaging 1.00
R6861:Mier2 UTSW 10 79541156 start gained probably benign
R6869:Mier2 UTSW 10 79542669 missense probably damaging 0.99
R6897:Mier2 UTSW 10 79544739 missense probably damaging 0.99
R6902:Mier2 UTSW 10 79540839 utr 3 prime probably benign
R6946:Mier2 UTSW 10 79540839 utr 3 prime probably benign
R6968:Mier2 UTSW 10 79540642 utr 3 prime probably benign
R6971:Mier2 UTSW 10 79542429 missense possibly damaging 0.53
R7072:Mier2 UTSW 10 79540299 missense unknown
R7350:Mier2 UTSW 10 79540298 missense unknown
R7443:Mier2 UTSW 10 79540455 missense unknown
R7506:Mier2 UTSW 10 79550342 missense probably benign 0.14
R7545:Mier2 UTSW 10 79541194 missense possibly damaging 0.79
R7625:Mier2 UTSW 10 79542709 missense probably damaging 1.00
R7669:Mier2 UTSW 10 79549676 missense probably damaging 1.00
R7895:Mier2 UTSW 10 79541885 start gained probably benign
R7978:Mier2 UTSW 10 79541885 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGGATGGCAACTCATCTTGC -3'
(R):5'- CGTTTACTGTCCTGTTCAAAGG -3'

Sequencing Primer
(F):5'- TGGAGAGCACCTGACAGTCTG -3'
(R):5'- CTTGCTTTCTGGGGAAGA -3'
Posted On2015-04-17