Incidental Mutation 'R3881:Cep95'
ID 308777
Institutional Source Beutler Lab
Gene Symbol Cep95
Ensembl Gene ENSMUSG00000018372
Gene Name centrosomal protein 95
Synonyms 4732496G21Rik, Ccdc45, F630025I20Rik
MMRRC Submission 040795-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R3881 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 106679466-106709687 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106697118 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 257 (I257V)
Ref Sequence ENSEMBL: ENSMUSP00000018516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018516] [ENSMUST00000103068]
AlphaFold Q8BVV7
Predicted Effect probably damaging
Transcript: ENSMUST00000018516
AA Change: I257V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018516
Gene: ENSMUSG00000018372
AA Change: I257V

DomainStartEndE-ValueType
low complexity region 389 407 N/A INTRINSIC
coiled coil region 584 633 N/A INTRINSIC
coiled coil region 701 793 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103068
AA Change: I214V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099357
Gene: ENSMUSG00000018372
AA Change: I214V

DomainStartEndE-ValueType
low complexity region 346 364 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
coiled coil region 658 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik T G 19: 4,548,417 (GRCm39) K44T possibly damaging Het
4933402N03Rik T C 7: 130,740,823 (GRCm39) E131G probably benign Het
Angptl4 G A 17: 33,996,008 (GRCm39) P323S possibly damaging Het
Cep41 A G 6: 30,658,397 (GRCm39) S201P probably damaging Het
Clca4a T C 3: 144,663,079 (GRCm39) N590S probably benign Het
Cyfip2 A G 11: 46,099,162 (GRCm39) L716P probably damaging Het
Cyp2d34 T A 15: 82,502,818 (GRCm39) Q136L probably benign Het
Def6 T C 17: 28,439,189 (GRCm39) C267R probably damaging Het
Dgat2 G A 7: 98,818,950 (GRCm39) Q69* probably null Het
Dlgap1 T A 17: 71,093,810 (GRCm39) S710R probably damaging Het
Dnah10 T C 5: 124,850,095 (GRCm39) I1539T probably benign Het
Dnah2 T A 11: 69,342,173 (GRCm39) I2932F possibly damaging Het
Enpp2 A G 15: 54,783,088 (GRCm39) S76P probably damaging Het
Esr2 T C 12: 76,214,394 (GRCm39) D19G probably damaging Het
Fam13b A T 18: 34,595,112 (GRCm39) probably null Het
Fbxw14 A T 9: 109,100,262 (GRCm39) V464D possibly damaging Het
Fcgbpl1 T A 7: 27,839,463 (GRCm39) C425* probably null Het
Gm21961 A G 15: 64,886,716 (GRCm39) probably null Het
Gpd2 C T 2: 57,228,987 (GRCm39) R264* probably null Het
Hps5 A G 7: 46,421,420 (GRCm39) V648A possibly damaging Het
Ints4 A G 7: 97,165,464 (GRCm39) T517A possibly damaging Het
Itpr3 A G 17: 27,332,814 (GRCm39) N1860S probably benign Het
Itsn2 G A 12: 4,684,546 (GRCm39) probably benign Het
Jup A G 11: 100,269,207 (GRCm39) V402A probably benign Het
Letm2 C A 8: 26,083,884 (GRCm39) E116* probably null Het
Ly6c1 T C 15: 74,917,436 (GRCm39) T71A probably benign Het
Mcm3ap G A 10: 76,342,280 (GRCm39) S1591N probably benign Het
Mier2 C T 10: 79,384,584 (GRCm39) probably null Het
Mocs2 T A 13: 114,955,882 (GRCm39) L10* probably null Het
Myo6 A G 9: 80,171,538 (GRCm39) D513G probably damaging Het
Myoz2 T C 3: 122,807,369 (GRCm39) Y147C probably damaging Het
Nin C T 12: 70,089,315 (GRCm39) V1367M probably benign Het
Nr2f6 C T 8: 71,828,675 (GRCm39) A200T probably damaging Het
Obscn C T 11: 58,947,775 (GRCm39) C4418Y probably damaging Het
Or10ak9 A G 4: 118,726,550 (GRCm39) M191V probably benign Het
Or10q12 T C 19: 13,746,144 (GRCm39) V146A probably benign Het
Or5g26 T A 2: 85,494,769 (GRCm39) H3L probably benign Het
Paxip1 C T 5: 27,953,837 (GRCm39) R953Q probably damaging Het
Pcdha1 A T 18: 37,064,454 (GRCm39) I373F possibly damaging Het
Pcdha7 G A 18: 37,108,432 (GRCm39) E486K probably benign Het
Recql5 G A 11: 115,784,780 (GRCm39) P849L probably benign Het
Recql5 G T 11: 115,784,781 (GRCm39) P849T probably benign Het
Rnf180 A T 13: 105,386,915 (GRCm39) M131K possibly damaging Het
Rplp1 A G 9: 61,821,704 (GRCm39) S3P probably benign Het
Rpp38 T A 2: 3,330,283 (GRCm39) R206S probably benign Het
Sdha G T 13: 74,487,311 (GRCm39) P159Q probably damaging Het
Shank2 T C 7: 143,959,121 (GRCm39) V199A probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Timm50 C A 7: 28,010,432 (GRCm39) A41S probably benign Het
Tmbim1 A G 1: 74,329,157 (GRCm39) probably benign Het
Tmprss11a C T 5: 86,593,664 (GRCm39) V29M possibly damaging Het
Ttc28 A T 5: 111,331,106 (GRCm39) H411L probably damaging Het
Ube4b A T 4: 149,449,861 (GRCm39) probably null Het
Zdhhc22 T A 12: 87,030,400 (GRCm39) M183L probably benign Het
Zfp106 A G 2: 120,362,630 (GRCm39) S830P probably benign Het
Other mutations in Cep95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cep95 APN 11 106,709,043 (GRCm39) missense probably damaging 0.98
IGL00988:Cep95 APN 11 106,697,220 (GRCm39) missense probably benign 0.00
IGL01306:Cep95 APN 11 106,704,641 (GRCm39) missense probably benign 0.00
IGL01995:Cep95 APN 11 106,697,197 (GRCm39) missense probably damaging 1.00
IGL02541:Cep95 APN 11 106,706,407 (GRCm39) missense probably damaging 0.99
ANU23:Cep95 UTSW 11 106,704,641 (GRCm39) missense probably benign 0.00
R0071:Cep95 UTSW 11 106,681,554 (GRCm39) unclassified probably benign
R0071:Cep95 UTSW 11 106,681,554 (GRCm39) unclassified probably benign
R0255:Cep95 UTSW 11 106,702,097 (GRCm39) missense probably benign 0.10
R0427:Cep95 UTSW 11 106,681,578 (GRCm39) missense probably benign 0.18
R0436:Cep95 UTSW 11 106,709,511 (GRCm39) missense probably null 0.98
R0583:Cep95 UTSW 11 106,705,449 (GRCm39) missense probably benign
R0831:Cep95 UTSW 11 106,705,530 (GRCm39) missense probably benign 0.00
R1459:Cep95 UTSW 11 106,708,781 (GRCm39) missense probably damaging 1.00
R1589:Cep95 UTSW 11 106,690,930 (GRCm39) missense probably benign 0.00
R1627:Cep95 UTSW 11 106,700,531 (GRCm39) missense probably damaging 1.00
R1768:Cep95 UTSW 11 106,697,177 (GRCm39) nonsense probably null
R1914:Cep95 UTSW 11 106,705,464 (GRCm39) missense probably damaging 1.00
R1915:Cep95 UTSW 11 106,705,464 (GRCm39) missense probably damaging 1.00
R1928:Cep95 UTSW 11 106,681,554 (GRCm39) unclassified probably benign
R2495:Cep95 UTSW 11 106,700,108 (GRCm39) missense possibly damaging 0.73
R3157:Cep95 UTSW 11 106,700,013 (GRCm39) splice site probably benign
R3158:Cep95 UTSW 11 106,700,013 (GRCm39) splice site probably benign
R3712:Cep95 UTSW 11 106,702,112 (GRCm39) nonsense probably null
R4739:Cep95 UTSW 11 106,706,560 (GRCm39) missense probably benign 0.34
R4908:Cep95 UTSW 11 106,702,172 (GRCm39) missense probably damaging 1.00
R4989:Cep95 UTSW 11 106,707,480 (GRCm39) splice site probably null
R5913:Cep95 UTSW 11 106,709,335 (GRCm39) unclassified probably benign
R5925:Cep95 UTSW 11 106,703,227 (GRCm39) missense probably benign 0.00
R6291:Cep95 UTSW 11 106,706,422 (GRCm39) missense probably damaging 1.00
R6540:Cep95 UTSW 11 106,692,328 (GRCm39) missense probably damaging 0.97
R6924:Cep95 UTSW 11 106,702,023 (GRCm39) missense probably damaging 0.99
R6985:Cep95 UTSW 11 106,709,529 (GRCm39) missense probably damaging 0.99
R7156:Cep95 UTSW 11 106,700,050 (GRCm39) missense possibly damaging 0.84
R7940:Cep95 UTSW 11 106,686,974 (GRCm39) missense probably benign
R8348:Cep95 UTSW 11 106,704,593 (GRCm39) missense possibly damaging 0.81
R8509:Cep95 UTSW 11 106,695,876 (GRCm39) missense probably benign 0.08
R8849:Cep95 UTSW 11 106,707,630 (GRCm39) missense
R9284:Cep95 UTSW 11 106,704,624 (GRCm39) missense probably benign
R9532:Cep95 UTSW 11 106,687,042 (GRCm39) missense probably damaging 0.98
R9673:Cep95 UTSW 11 106,703,322 (GRCm39) missense probably benign 0.05
X0028:Cep95 UTSW 11 106,703,236 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGCTCAGTGGAAGAGAGTGCC -3'
(R):5'- GCTTCTAGCCAATTATAAGAAGACC -3'

Sequencing Primer
(F):5'- TCTGTAACAGAGAGATCTGACGCC -3'
(R):5'- CTTTCCACTTACCACAGAAGGTGC -3'
Posted On 2015-04-17