Incidental Mutation 'R3881:Esr2'
ID308783
Institutional Source Beutler Lab
Gene Symbol Esr2
Ensembl Gene ENSMUSG00000021055
Gene Nameestrogen receptor 2 (beta)
SynonymsERbeta, ER beta, Estrb, oestrogen receptor beta
MMRRC Submission 040795-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R3881 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location76120419-76177259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76167620 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 19 (D19G)
Ref Sequence ENSEMBL: ENSMUSP00000151463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076634] [ENSMUST00000101291] [ENSMUST00000110421] [ENSMUST00000133564] [ENSMUST00000218621]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076634
AA Change: D19G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075932
Gene: ENSMUSG00000021055
AA Change: D19G

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 143 4.2e-41 PFAM
ZnF_C4 165 236 1.84e-34 SMART
HOLI 319 488 5.99e-34 SMART
Blast:HOLI 489 519 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000101291
SMART Domains Protein: ENSMUSP00000098849
Gene: ENSMUSG00000021055

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 141 1.9e-56 PFAM
ZnF_C4 165 236 1.84e-34 SMART
HOLI 319 506 6.88e-34 SMART
Blast:HOLI 507 537 8e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000110421
SMART Domains Protein: ENSMUSP00000106051
Gene: ENSMUSG00000021055

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 143 4.2e-41 PFAM
ZnF_C4 165 236 1.84e-34 SMART
HOLI 319 488 5.99e-34 SMART
Blast:HOLI 489 519 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000133564
SMART Domains Protein: ENSMUSP00000138637
Gene: ENSMUSG00000021055

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 143 1.1e-41 PFAM
ZnF_C4 165 236 1.84e-34 SMART
PDB:2J7Y|A 274 337 1e-33 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000218621
AA Change: D19G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of estrogen receptors and superfamily of nuclear receptor transcription factors. The gene product contains an N-terminal DNA binding domain and C-terminal ligand binding domain and is localized to the nucleus, cytoplasm, and mitochondria. Upon binding to 17beta-estradiol or related ligands, the encoded protein forms homo- or hetero-dimers that interact with specific DNA sequences to activate transcription. Some isoforms dominantly inhibit the activity of other estrogen receptor family members. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neural, behavior, glucose homeostasis, sex-specific nociception, cardiac, and ion channel abnormalities and myeloproliferative disorders. Females are sterile/subfertile with granulosa cell defects; males show prostate hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik T G 19: 4,498,389 K44T possibly damaging Het
4933402N03Rik T C 7: 131,139,094 E131G probably benign Het
9530053A07Rik T A 7: 28,140,038 C425* probably null Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Cep41 A G 6: 30,658,398 S201P probably damaging Het
Cep95 A G 11: 106,806,292 I257V probably damaging Het
Clca4a T C 3: 144,957,318 N590S probably benign Het
Cyfip2 A G 11: 46,208,335 L716P probably damaging Het
Cyp2d34 T A 15: 82,618,617 Q136L probably benign Het
Def6 T C 17: 28,220,215 C267R probably damaging Het
Dgat2 G A 7: 99,169,743 Q69* probably null Het
Dlgap1 T A 17: 70,786,815 S710R probably damaging Het
Dnah10 T C 5: 124,773,031 I1539T probably benign Het
Dnah2 T A 11: 69,451,347 I2932F possibly damaging Het
Enpp2 A G 15: 54,919,692 S76P probably damaging Het
Fam13b A T 18: 34,462,059 probably null Het
Fbxw14 A T 9: 109,271,194 V464D possibly damaging Het
Gm21961 A G 15: 65,014,867 probably null Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Hps5 A G 7: 46,771,996 V648A possibly damaging Het
Ints4 A G 7: 97,516,257 T517A possibly damaging Het
Itpr3 A G 17: 27,113,840 N1860S probably benign Het
Itsn2 G A 12: 4,634,546 probably benign Het
Jup A G 11: 100,378,381 V402A probably benign Het
Letm2 C A 8: 25,593,868 E116* probably null Het
Ly6c1 T C 15: 75,045,587 T71A probably benign Het
Mcm3ap G A 10: 76,506,446 S1591N probably benign Het
Mier2 C T 10: 79,548,750 probably null Het
Mocs2 T A 13: 114,819,346 L10* probably null Het
Myo6 A G 9: 80,264,256 D513G probably damaging Het
Myoz2 T C 3: 123,013,720 Y147C probably damaging Het
Nin C T 12: 70,042,541 V1367M probably benign Het
Nr2f6 C T 8: 71,376,031 A200T probably damaging Het
Obscn C T 11: 59,056,949 C4418Y probably damaging Het
Olfr1331 A G 4: 118,869,353 M191V probably benign Het
Olfr1495 T C 19: 13,768,780 V146A probably benign Het
Olfr154 T A 2: 85,664,425 H3L probably benign Het
Paxip1 C T 5: 27,748,839 R953Q probably damaging Het
Pcdha1 A T 18: 36,931,401 I373F possibly damaging Het
Pcdha7 G A 18: 36,975,379 E486K probably benign Het
Recql5 G A 11: 115,893,954 P849L probably benign Het
Recql5 G T 11: 115,893,955 P849T probably benign Het
Rnf180 A T 13: 105,250,407 M131K possibly damaging Het
Rplp1 A G 9: 61,914,422 S3P probably benign Het
Rpp38 T A 2: 3,329,246 R206S probably benign Het
Sdha G T 13: 74,339,192 P159Q probably damaging Het
Shank2 T C 7: 144,405,384 V199A probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Timm50 C A 7: 28,311,007 A41S probably benign Het
Tmbim1 A G 1: 74,289,998 probably benign Het
Tmprss11a C T 5: 86,445,805 V29M possibly damaging Het
Ttc28 A T 5: 111,183,240 H411L probably damaging Het
Ube4b A T 4: 149,365,404 probably null Het
Zdhhc22 T A 12: 86,983,626 M183L probably benign Het
Zfp106 A G 2: 120,532,149 S830P probably benign Het
Other mutations in Esr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Esr2 APN 12 76133896 missense probably damaging 1.00
IGL00435:Esr2 APN 12 76133879 missense probably damaging 1.00
IGL01591:Esr2 APN 12 76121724 utr 3 prime probably benign
IGL01695:Esr2 APN 12 76145319 missense probably damaging 1.00
IGL02142:Esr2 APN 12 76123195 missense probably benign 0.02
IGL02343:Esr2 APN 12 76145345 missense probably benign 0.01
IGL02584:Esr2 APN 12 76145262 missense probably damaging 1.00
R0380:Esr2 UTSW 12 76123291 missense possibly damaging 0.81
R0975:Esr2 UTSW 12 76145308 missense possibly damaging 0.49
R2075:Esr2 UTSW 12 76165447 critical splice donor site probably null
R4475:Esr2 UTSW 12 76133942 missense probably benign 0.04
R4520:Esr2 UTSW 12 76167549 missense possibly damaging 0.91
R4636:Esr2 UTSW 12 76123324 missense possibly damaging 0.50
R5167:Esr2 UTSW 12 76123274 missense probably benign 0.00
R6163:Esr2 UTSW 12 76121869 missense probably damaging 1.00
R6928:Esr2 UTSW 12 76165478 missense probably damaging 1.00
R6965:Esr2 UTSW 12 76121857 missense probably damaging 0.97
R7441:Esr2 UTSW 12 76141394 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACATTTGGGCTTGCAGTC -3'
(R):5'- ACCATTGCCCCTAGCTAAAATG -3'

Sequencing Primer
(F):5'- CTGCTGGGAACACTGTAGTTC -3'
(R):5'- GAATACTTCTTAGTTACTCCGGCAG -3'
Posted On2015-04-17