Incidental Mutation 'R3881:Fam13b'
ID 308796
Institutional Source Beutler Lab
Gene Symbol Fam13b
Ensembl Gene ENSMUSG00000036501
Gene Name family with sequence similarity 13, member B
Synonyms 2610024E20Rik
MMRRC Submission 040795-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R3881 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 34442352-34506823 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 34462059 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040506]
AlphaFold Q8K2H3
Predicted Effect probably null
Transcript: ENSMUST00000040506
SMART Domains Protein: ENSMUSP00000038199
Gene: ENSMUSG00000036501

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
RhoGAP 36 209 3.28e-44 SMART
coiled coil region 220 240 N/A INTRINSIC
low complexity region 280 295 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 507 532 N/A INTRINSIC
low complexity region 719 726 N/A INTRINSIC
coiled coil region 778 807 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik T G 19: 4,498,389 K44T possibly damaging Het
4933402N03Rik T C 7: 131,139,094 E131G probably benign Het
9530053A07Rik T A 7: 28,140,038 C425* probably null Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Cep41 A G 6: 30,658,398 S201P probably damaging Het
Cep95 A G 11: 106,806,292 I257V probably damaging Het
Clca4a T C 3: 144,957,318 N590S probably benign Het
Cyfip2 A G 11: 46,208,335 L716P probably damaging Het
Cyp2d34 T A 15: 82,618,617 Q136L probably benign Het
Def6 T C 17: 28,220,215 C267R probably damaging Het
Dgat2 G A 7: 99,169,743 Q69* probably null Het
Dlgap1 T A 17: 70,786,815 S710R probably damaging Het
Dnah10 T C 5: 124,773,031 I1539T probably benign Het
Dnah2 T A 11: 69,451,347 I2932F possibly damaging Het
Enpp2 A G 15: 54,919,692 S76P probably damaging Het
Esr2 T C 12: 76,167,620 D19G probably damaging Het
Fbxw14 A T 9: 109,271,194 V464D possibly damaging Het
Gm21961 A G 15: 65,014,867 probably null Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Hps5 A G 7: 46,771,996 V648A possibly damaging Het
Ints4 A G 7: 97,516,257 T517A possibly damaging Het
Itpr3 A G 17: 27,113,840 N1860S probably benign Het
Itsn2 G A 12: 4,634,546 probably benign Het
Jup A G 11: 100,378,381 V402A probably benign Het
Letm2 C A 8: 25,593,868 E116* probably null Het
Ly6c1 T C 15: 75,045,587 T71A probably benign Het
Mcm3ap G A 10: 76,506,446 S1591N probably benign Het
Mier2 C T 10: 79,548,750 probably null Het
Mocs2 T A 13: 114,819,346 L10* probably null Het
Myo6 A G 9: 80,264,256 D513G probably damaging Het
Myoz2 T C 3: 123,013,720 Y147C probably damaging Het
Nin C T 12: 70,042,541 V1367M probably benign Het
Nr2f6 C T 8: 71,376,031 A200T probably damaging Het
Obscn C T 11: 59,056,949 C4418Y probably damaging Het
Olfr1331 A G 4: 118,869,353 M191V probably benign Het
Olfr1495 T C 19: 13,768,780 V146A probably benign Het
Olfr154 T A 2: 85,664,425 H3L probably benign Het
Paxip1 C T 5: 27,748,839 R953Q probably damaging Het
Pcdha1 A T 18: 36,931,401 I373F possibly damaging Het
Pcdha7 G A 18: 36,975,379 E486K probably benign Het
Recql5 G A 11: 115,893,954 P849L probably benign Het
Recql5 G T 11: 115,893,955 P849T probably benign Het
Rnf180 A T 13: 105,250,407 M131K possibly damaging Het
Rplp1 A G 9: 61,914,422 S3P probably benign Het
Rpp38 T A 2: 3,329,246 R206S probably benign Het
Sdha G T 13: 74,339,192 P159Q probably damaging Het
Shank2 T C 7: 144,405,384 V199A probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Timm50 C A 7: 28,311,007 A41S probably benign Het
Tmbim1 A G 1: 74,289,998 probably benign Het
Tmprss11a C T 5: 86,445,805 V29M possibly damaging Het
Ttc28 A T 5: 111,183,240 H411L probably damaging Het
Ube4b A T 4: 149,365,404 probably null Het
Zdhhc22 T A 12: 86,983,626 M183L probably benign Het
Zfp106 A G 2: 120,532,149 S830P probably benign Het
Other mutations in Fam13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Fam13b APN 18 34487096 missense possibly damaging 0.92
IGL00402:Fam13b APN 18 34454718 missense probably damaging 1.00
IGL00556:Fam13b APN 18 34497435 missense probably damaging 0.99
IGL02123:Fam13b APN 18 34445618 unclassified probably benign
IGL02313:Fam13b APN 18 34454656 missense probably damaging 1.00
IGL02346:Fam13b APN 18 34462105 missense probably benign 0.00
IGL02347:Fam13b APN 18 34454704 missense probably damaging 1.00
IGL02694:Fam13b APN 18 34451206 critical splice donor site probably null
IGL03347:Fam13b APN 18 34462051 splice site probably benign
R0109:Fam13b UTSW 18 34451308 missense probably benign 0.00
R0233:Fam13b UTSW 18 34448084 missense probably damaging 1.00
R0455:Fam13b UTSW 18 34445528 unclassified probably benign
R1229:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1397:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1571:Fam13b UTSW 18 34497432 missense possibly damaging 0.92
R1703:Fam13b UTSW 18 34451439 critical splice acceptor site probably null
R1732:Fam13b UTSW 18 34487134 missense probably benign 0.04
R1777:Fam13b UTSW 18 34457760 missense possibly damaging 0.84
R1956:Fam13b UTSW 18 34445329 missense possibly damaging 0.69
R2296:Fam13b UTSW 18 34494761 missense possibly damaging 0.88
R3896:Fam13b UTSW 18 34462955 splice site probably benign
R5277:Fam13b UTSW 18 34462190 missense probably benign
R5759:Fam13b UTSW 18 34497435 missense probably damaging 0.99
R5817:Fam13b UTSW 18 34457797 missense possibly damaging 0.93
R5897:Fam13b UTSW 18 34454081 missense possibly damaging 0.83
R6009:Fam13b UTSW 18 34497405 missense possibly damaging 0.92
R6020:Fam13b UTSW 18 34494774 missense probably damaging 1.00
R6087:Fam13b UTSW 18 34487139 missense possibly damaging 0.48
R6151:Fam13b UTSW 18 34494277 missense probably damaging 0.96
R6454:Fam13b UTSW 18 34457662 critical splice donor site probably null
R6464:Fam13b UTSW 18 34473631 nonsense probably null
R6679:Fam13b UTSW 18 34487022 missense possibly damaging 0.53
R6723:Fam13b UTSW 18 34498026 missense possibly damaging 0.86
R6990:Fam13b UTSW 18 34497447 missense possibly damaging 0.92
R7420:Fam13b UTSW 18 34494611 missense probably damaging 1.00
R7517:Fam13b UTSW 18 34494607 missense probably damaging 0.98
R7534:Fam13b UTSW 18 34498007 missense probably damaging 0.97
R7889:Fam13b UTSW 18 34457691 missense probably benign 0.00
R8139:Fam13b UTSW 18 34473633 missense possibly damaging 0.50
R8776:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8776-TAIL:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8826:Fam13b UTSW 18 34498017 missense probably damaging 0.96
R9166:Fam13b UTSW 18 34462199 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTCTACCCACGAGAGAGCTG -3'
(R):5'- GTCTCTGAGACAGTTGTGAAAAGAG -3'

Sequencing Primer
(F):5'- AGAGAGCTGCCCTACTAGTGTAC -3'
(R):5'- CAGTTGTGAAAAGAGTCATGGTTATG -3'
Posted On 2015-04-17