Incidental Mutation 'R3881:Tex11'
ID 308798
Institutional Source Beutler Lab
Gene Symbol Tex11
Ensembl Gene ENSMUSG00000009670
Gene Name testis expressed gene 11
Synonyms 4930565P14Rik
MMRRC Submission 040795-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock # R3881 (G1)
Quality Score 222
Status Not validated
Chromosome X
Chromosomal Location 100838648-101059667 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 100933415 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 487 (A487S)
Ref Sequence ENSEMBL: ENSMUSP00000109347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009814] [ENSMUST00000113716] [ENSMUST00000113718]
AlphaFold Q14AT2
Predicted Effect possibly damaging
Transcript: ENSMUST00000009814
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000009814
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 176 431 1.1e-62 PFAM
low complexity region 702 713 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113716
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109345
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 175 433 2.1e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113718
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109347
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 175 433 3.8e-70 PFAM
low complexity region 702 713 N/A INTRINSIC
Meta Mutation Damage Score 0.3188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is X-linked and is expressed in only male germ cells. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Miche homozygous for a knockout allele exhibit abnormal male meiosis. Mice homozygous for a conditional knockout exhibit male infertility and reduced female fecundity due to abnormal meiosis following cre recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik T G 19: 4,498,389 K44T possibly damaging Het
4933402N03Rik T C 7: 131,139,094 E131G probably benign Het
9530053A07Rik T A 7: 28,140,038 C425* probably null Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Cep41 A G 6: 30,658,398 S201P probably damaging Het
Cep95 A G 11: 106,806,292 I257V probably damaging Het
Clca4a T C 3: 144,957,318 N590S probably benign Het
Cyfip2 A G 11: 46,208,335 L716P probably damaging Het
Cyp2d34 T A 15: 82,618,617 Q136L probably benign Het
Def6 T C 17: 28,220,215 C267R probably damaging Het
Dgat2 G A 7: 99,169,743 Q69* probably null Het
Dlgap1 T A 17: 70,786,815 S710R probably damaging Het
Dnah10 T C 5: 124,773,031 I1539T probably benign Het
Dnah2 T A 11: 69,451,347 I2932F possibly damaging Het
Enpp2 A G 15: 54,919,692 S76P probably damaging Het
Esr2 T C 12: 76,167,620 D19G probably damaging Het
Fam13b A T 18: 34,462,059 probably null Het
Fbxw14 A T 9: 109,271,194 V464D possibly damaging Het
Gm21961 A G 15: 65,014,867 probably null Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Hps5 A G 7: 46,771,996 V648A possibly damaging Het
Ints4 A G 7: 97,516,257 T517A possibly damaging Het
Itpr3 A G 17: 27,113,840 N1860S probably benign Het
Itsn2 G A 12: 4,634,546 probably benign Het
Jup A G 11: 100,378,381 V402A probably benign Het
Letm2 C A 8: 25,593,868 E116* probably null Het
Ly6c1 T C 15: 75,045,587 T71A probably benign Het
Mcm3ap G A 10: 76,506,446 S1591N probably benign Het
Mier2 C T 10: 79,548,750 probably null Het
Mocs2 T A 13: 114,819,346 L10* probably null Het
Myo6 A G 9: 80,264,256 D513G probably damaging Het
Myoz2 T C 3: 123,013,720 Y147C probably damaging Het
Nin C T 12: 70,042,541 V1367M probably benign Het
Nr2f6 C T 8: 71,376,031 A200T probably damaging Het
Obscn C T 11: 59,056,949 C4418Y probably damaging Het
Olfr1331 A G 4: 118,869,353 M191V probably benign Het
Olfr1495 T C 19: 13,768,780 V146A probably benign Het
Olfr154 T A 2: 85,664,425 H3L probably benign Het
Paxip1 C T 5: 27,748,839 R953Q probably damaging Het
Pcdha1 A T 18: 36,931,401 I373F possibly damaging Het
Pcdha7 G A 18: 36,975,379 E486K probably benign Het
Recql5 G A 11: 115,893,954 P849L probably benign Het
Recql5 G T 11: 115,893,955 P849T probably benign Het
Rnf180 A T 13: 105,250,407 M131K possibly damaging Het
Rplp1 A G 9: 61,914,422 S3P probably benign Het
Rpp38 T A 2: 3,329,246 R206S probably benign Het
Sdha G T 13: 74,339,192 P159Q probably damaging Het
Shank2 T C 7: 144,405,384 V199A probably benign Het
Timm50 C A 7: 28,311,007 A41S probably benign Het
Tmbim1 A G 1: 74,289,998 probably benign Het
Tmprss11a C T 5: 86,445,805 V29M possibly damaging Het
Ttc28 A T 5: 111,183,240 H411L probably damaging Het
Ube4b A T 4: 149,365,404 probably null Het
Zdhhc22 T A 12: 86,983,626 M183L probably benign Het
Zfp106 A G 2: 120,532,149 S830P probably benign Het
Other mutations in Tex11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Tex11 APN X 101032559 missense probably null 0.00
IGL00838:Tex11 APN X 100972118 missense possibly damaging 0.92
IGL02385:Tex11 APN X 100876529 splice site probably benign
R2958:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R2960:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R2963:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3008:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3009:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3010:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3011:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3745:Tex11 UTSW X 100916572 missense probably benign 0.33
R3882:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4081:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4082:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4159:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4172:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4197:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4201:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4204:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4206:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4304:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4305:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R8726:Tex11 UTSW X 101015585 missense possibly damaging 0.82
R8727:Tex11 UTSW X 101015585 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCTCAAATGATGGTTTCCCGAATTC -3'
(R):5'- GAGTACTCCTCAACAATTGTGTC -3'

Sequencing Primer
(F):5'- AATGATGGTTTCCCGAATTCTTGTC -3'
(R):5'- GCCATAGCAGAAGTTGAG -3'
Posted On 2015-04-17