Mutagenetix > Incidental Mutation

Incidental Mutation 'R3883:Serpinb13'

308801

Institutional Source

Beutler Lab

Gene Symbol

Serpinb13

Ensembl Gene

ENSMUSG00000048775

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13

Synonyms

HURPIN, headpin, HUR7, PI13

MMRRC Submission

040796-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R3883 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106980984-107001195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106998572 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 159 (V159A)

Ref Sequence

ENSEMBL: ENSMUSP00000027564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]

AlphaFold

Q8CDC0

Predicted Effect

probably benign
Transcript: ENSMUST00000027564
AA Change: V159A

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: V159A

Domain	Start	End	E-Value	Type
SERPIN	13	389	1.55e-144	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000136766

SMART Domains

Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	94	1.1e-16	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl1	C	T	8: 46,527,191	S423L	probably benign	Het
Ankmy1	T	G	1: 92,886,152	E435A	probably damaging	Het
Ano5	T	A	7: 51,566,304	M343K	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
C3	T	C	17: 57,217,173		probably null	Het
C530008M17Rik	T	A	5: 76,856,574	W261R	unknown	Het
Cdk17	T	C	10: 93,212,077		probably null	Het
Cntn2	A	G	1: 132,528,939	V123A	probably damaging	Het
Dchs1	A	G	7: 105,762,563	Y1449H	probably damaging	Het
Ddx42	T	A	11: 106,247,692	N772K	probably benign	Het
Dnah11	T	C	12: 117,978,453		probably benign	Het
Edn1	T	A	13: 42,301,906	F4L	probably benign	Het
Epb41l3	C	T	17: 69,274,116	R552*	probably null	Het
Epc1	T	C	18: 6,452,258	D267G	possibly damaging	Het
Fbxo22	A	T	9: 55,223,262	T169S	probably benign	Het
Fmnl1	A	G	11: 103,182,114	N144D	probably damaging	Het
Folh1	A	G	7: 86,775,656	L35P	possibly damaging	Het
Gm10220	A	C	5: 26,116,910	S255A	possibly damaging	Het
Gm15446	G	T	5: 109,940,447	V9L	probably damaging	Het
Hipk2	A	G	6: 38,699,265	L1011P	probably damaging	Het
Kif4-ps	G	T	12: 101,146,214	V201L	probably damaging	Het
Klk1b16	T	C	7: 44,139,463	V40A	possibly damaging	Het
Lgsn	C	A	1: 31,176,459	D3E	probably benign	Het
Mavs	T	C	2: 131,245,298	S239P	probably benign	Het
Mkl2	T	A	16: 13,401,458	V667D	probably damaging	Het
Mtrf1	A	G	14: 79,419,267	Y403C	probably damaging	Het
Mycbp2	A	C	14: 103,295,250	L390V	probably damaging	Het
Neto2	A	G	8: 85,663,265	S190P	probably damaging	Het
Ngly1	A	G	14: 16,270,574	I195V	probably damaging	Het
Olfr1339	T	C	4: 118,734,685	I52T	probably benign	Het
Olfr961	A	G	9: 39,647,124	I133V	probably benign	Het
Pde4dip	T	C	3: 97,713,188	K1632E	probably damaging	Het
Pigk	T	C	3: 152,714,195	S21P	probably benign	Het
Rabggtb	A	G	3: 153,910,780	F82L	probably damaging	Het
Reep6	G	A	10: 80,335,535	R415Q	probably benign	Het
Slc5a8	T	A	10: 88,902,463	M196K	possibly damaging	Het
Sprr1a	G	A	3: 92,484,520	P58L	probably damaging	Het
Taf1a	A	T	1: 183,390,948	T10S	possibly damaging	Het
Tap1	T	A	17: 34,193,258	V479E	probably damaging	Het
Trpm4	C	T	7: 45,321,998		probably null	Het
Ush2a	T	C	1: 188,263,382	Y117H	probably benign	Het
Vmn2r58	A	T	7: 41,864,490	L243*	probably null	Het
Zbtb32	A	G	7: 30,591,144	I242T	probably benign	Het
Zbtb7a	T	C	10: 81,148,025	C434R	probably damaging	Het

Other mutations in Serpinb13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Serpinb13	APN	1	106996380	missense	probably damaging	1.00
IGL01758:Serpinb13	APN	1	107000754	missense	probably damaging	1.00
IGL02078:Serpinb13	APN	1	106998958	missense	probably damaging	0.99
IGL02183:Serpinb13	APN	1	106998910	missense	probably damaging	1.00
PIT4651001:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R0683:Serpinb13	UTSW	1	106999021	missense	probably damaging	1.00
R1263:Serpinb13	UTSW	1	107000736	missense	probably damaging	0.97
R1535:Serpinb13	UTSW	1	106982156	start codon destroyed	probably null	1.00
R1929:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2271:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2655:Serpinb13	UTSW	1	107000427	missense	probably damaging	0.99
R3115:Serpinb13	UTSW	1	106982838	missense	probably null	0.15
R3418:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3419:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R4664:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4666:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4689:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4690:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4725:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4728:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4847:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R5249:Serpinb13	UTSW	1	106998697	missense	probably damaging	1.00
R5501:Serpinb13	UTSW	1	106982185	missense	possibly damaging	0.81
R5507:Serpinb13	UTSW	1	106998602	missense	probably benign	0.00
R6015:Serpinb13	UTSW	1	107000607	missense	probably benign	0.00
R6363:Serpinb13	UTSW	1	107000774	nonsense	probably null
R6720:Serpinb13	UTSW	1	106994062	missense	probably benign	0.12
R6847:Serpinb13	UTSW	1	106998933	missense	probably benign	0.24
R7237:Serpinb13	UTSW	1	106998949	missense	probably damaging	1.00
R8907:Serpinb13	UTSW	1	107000789	missense	probably damaging	1.00
R8966:Serpinb13	UTSW	1	107000435	missense	probably damaging	1.00
R9011:Serpinb13	UTSW	1	106995789	missense	probably benign	0.01
R9350:Serpinb13	UTSW	1	106995832	nonsense	probably null
R9375:Serpinb13	UTSW	1	106982267	missense	probably damaging	1.00
R9774:Serpinb13	UTSW	1	106995849	missense	probably benign	0.02
Z1177:Serpinb13	UTSW	1	106982303	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CAGTATGAGAAAGTCCCCACTG -3'
(R):5'- CAGTGGCAAAAGTCTGAGTAACTG -3'

Sequencing Primer
(F):5'- TGACCCTTGGTGAGCAAGG -3'
(R):5'- CACTTGGCCAAATGACATTAGACTG -3'

Posted On

2015-04-17