Incidental Mutation 'R3883:Pde4dip'
ID308808
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Namephosphodiesterase 4D interacting protein (myomegalin)
SynonymsD130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
MMRRC Submission 040796-MU
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3883 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location97689824-97888707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97713188 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1632 (K1632E)
Ref Sequence ENSEMBL: ENSMUSP00000088254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090750] [ENSMUST00000168438]
Predicted Effect probably damaging
Transcript: ENSMUST00000090750
AA Change: K1632E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: K1632E

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168438
AA Change: K1632E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: K1632E

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Meta Mutation Damage Score 0.3550 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 C T 8: 46,527,191 S423L probably benign Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ano5 T A 7: 51,566,304 M343K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
C3 T C 17: 57,217,173 probably null Het
C530008M17Rik T A 5: 76,856,574 W261R unknown Het
Cdk17 T C 10: 93,212,077 probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Dchs1 A G 7: 105,762,563 Y1449H probably damaging Het
Ddx42 T A 11: 106,247,692 N772K probably benign Het
Dnah11 T C 12: 117,978,453 probably benign Het
Edn1 T A 13: 42,301,906 F4L probably benign Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Epc1 T C 18: 6,452,258 D267G possibly damaging Het
Fbxo22 A T 9: 55,223,262 T169S probably benign Het
Fmnl1 A G 11: 103,182,114 N144D probably damaging Het
Folh1 A G 7: 86,775,656 L35P possibly damaging Het
Gm10220 A C 5: 26,116,910 S255A possibly damaging Het
Gm15446 G T 5: 109,940,447 V9L probably damaging Het
Hipk2 A G 6: 38,699,265 L1011P probably damaging Het
Kif4-ps G T 12: 101,146,214 V201L probably damaging Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lgsn C A 1: 31,176,459 D3E probably benign Het
Mavs T C 2: 131,245,298 S239P probably benign Het
Mkl2 T A 16: 13,401,458 V667D probably damaging Het
Mtrf1 A G 14: 79,419,267 Y403C probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Neto2 A G 8: 85,663,265 S190P probably damaging Het
Ngly1 A G 14: 16,270,574 I195V probably damaging Het
Olfr1339 T C 4: 118,734,685 I52T probably benign Het
Olfr961 A G 9: 39,647,124 I133V probably benign Het
Pigk T C 3: 152,714,195 S21P probably benign Het
Rabggtb A G 3: 153,910,780 F82L probably damaging Het
Reep6 G A 10: 80,335,535 R415Q probably benign Het
Serpinb13 T C 1: 106,998,572 V159A probably benign Het
Slc5a8 T A 10: 88,902,463 M196K possibly damaging Het
Sprr1a G A 3: 92,484,520 P58L probably damaging Het
Taf1a A T 1: 183,390,948 T10S possibly damaging Het
Tap1 T A 17: 34,193,258 V479E probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ush2a T C 1: 188,263,382 Y117H probably benign Het
Vmn2r58 A T 7: 41,864,490 L243* probably null Het
Zbtb32 A G 7: 30,591,144 I242T probably benign Het
Zbtb7a T C 10: 81,148,025 C434R probably damaging Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1769:Pde4dip UTSW 3 97695930 missense probably benign 0.00
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97724218 missense probably damaging 0.98
R2158:Pde4dip UTSW 3 97757621 missense probably benign 0.15
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4770:Pde4dip UTSW 3 97767084 missense probably damaging 1.00
R4841:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97715328 missense probably benign 0.10
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5689:Pde4dip UTSW 3 97692367 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97755591 nonsense probably null
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6862:Pde4dip UTSW 3 97767024 missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97715422 missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
R7354:Pde4dip UTSW 3 97719330 missense probably damaging 0.99
R7357:Pde4dip UTSW 3 97715541 missense probably benign 0.01
R7360:Pde4dip UTSW 3 97718316 missense probably benign 0.01
R7371:Pde4dip UTSW 3 97757271 missense probably benign 0.08
R7432:Pde4dip UTSW 3 97695092 missense probably benign
R7536:Pde4dip UTSW 3 97757244 missense probably damaging 1.00
R7542:Pde4dip UTSW 3 97766655 missense possibly damaging 0.59
R7609:Pde4dip UTSW 3 97715565 missense possibly damaging 0.85
R7650:Pde4dip UTSW 3 97699107 critical splice donor site probably null
R7800:Pde4dip UTSW 3 97715283 missense probably damaging 1.00
R7846:Pde4dip UTSW 3 97715174 missense probably damaging 1.00
R7918:Pde4dip UTSW 3 97715223 nonsense probably null
R8120:Pde4dip UTSW 3 97706938 missense probably null 0.94
R8139:Pde4dip UTSW 3 97696993 missense probably benign 0.02
R8144:Pde4dip UTSW 3 97715426 missense probably damaging 1.00
R8177:Pde4dip UTSW 3 97767532 missense probably damaging 0.98
R8294:Pde4dip UTSW 3 97767378 missense probably damaging 1.00
R8406:Pde4dip UTSW 3 97699112 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACACAATGCTGTTGCGGAC -3'
(R):5'- AGTAGGATTCTGAGCTGGGAGC -3'

Sequencing Primer
(F):5'- CACAATGCTGTTGCGGACATATG -3'
(R):5'- GGACTCTAAGGAGCTTCTGTAAC -3'
Posted On2015-04-17