Incidental Mutation 'R3883:Trpm4'
ID308819
Institutional Source Beutler Lab
Gene Symbol Trpm4
Ensembl Gene ENSMUSG00000038260
Gene Nametransient receptor potential cation channel, subfamily M, member 4
SynonymsLTRPC4, TRPM4B, 1110030C19Rik
MMRRC Submission 040796-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R3883 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45302632-45333780 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 45321998 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042194] [ENSMUST00000210541] [ENSMUST00000211431] [ENSMUST00000211743] [ENSMUST00000211743]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000026901
Predicted Effect probably null
Transcript: ENSMUST00000042194
SMART Domains Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
SCOP:d1awcb_ 378 465 2e-3 SMART
low complexity region 600 612 N/A INTRINSIC
low complexity region 637 645 N/A INTRINSIC
transmembrane domain 688 710 N/A INTRINSIC
Pfam:Ion_trans 781 1051 1.8e-13 PFAM
low complexity region 1089 1096 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210541
Predicted Effect probably benign
Transcript: ENSMUST00000211431
Predicted Effect probably null
Transcript: ENSMUST00000211743
Predicted Effect probably null
Transcript: ENSMUST00000211743
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display increased Ca2+ influx and IgE-dependent mast cell activation, increased vascular permeability, and enhanced acute anaphylactic responses. Mice homozygous for a different knock-out allele show Ca2+ overload and impaired dendritic cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 C T 8: 46,527,191 S423L probably benign Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ano5 T A 7: 51,566,304 M343K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
C3 T C 17: 57,217,173 probably null Het
C530008M17Rik T A 5: 76,856,574 W261R unknown Het
Cdk17 T C 10: 93,212,077 probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Dchs1 A G 7: 105,762,563 Y1449H probably damaging Het
Ddx42 T A 11: 106,247,692 N772K probably benign Het
Dnah11 T C 12: 117,978,453 probably benign Het
Edn1 T A 13: 42,301,906 F4L probably benign Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Epc1 T C 18: 6,452,258 D267G possibly damaging Het
Fbxo22 A T 9: 55,223,262 T169S probably benign Het
Fmnl1 A G 11: 103,182,114 N144D probably damaging Het
Folh1 A G 7: 86,775,656 L35P possibly damaging Het
Gm10220 A C 5: 26,116,910 S255A possibly damaging Het
Gm15446 G T 5: 109,940,447 V9L probably damaging Het
Hipk2 A G 6: 38,699,265 L1011P probably damaging Het
Kif4-ps G T 12: 101,146,214 V201L probably damaging Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lgsn C A 1: 31,176,459 D3E probably benign Het
Mavs T C 2: 131,245,298 S239P probably benign Het
Mkl2 T A 16: 13,401,458 V667D probably damaging Het
Mtrf1 A G 14: 79,419,267 Y403C probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Neto2 A G 8: 85,663,265 S190P probably damaging Het
Ngly1 A G 14: 16,270,574 I195V probably damaging Het
Olfr1339 T C 4: 118,734,685 I52T probably benign Het
Olfr961 A G 9: 39,647,124 I133V probably benign Het
Pde4dip T C 3: 97,713,188 K1632E probably damaging Het
Pigk T C 3: 152,714,195 S21P probably benign Het
Rabggtb A G 3: 153,910,780 F82L probably damaging Het
Reep6 G A 10: 80,335,535 R415Q probably benign Het
Serpinb13 T C 1: 106,998,572 V159A probably benign Het
Slc5a8 T A 10: 88,902,463 M196K possibly damaging Het
Sprr1a G A 3: 92,484,520 P58L probably damaging Het
Taf1a A T 1: 183,390,948 T10S possibly damaging Het
Tap1 T A 17: 34,193,258 V479E probably damaging Het
Ush2a T C 1: 188,263,382 Y117H probably benign Het
Vmn2r58 A T 7: 41,864,490 L243* probably null Het
Zbtb32 A G 7: 30,591,144 I242T probably benign Het
Zbtb7a T C 10: 81,148,025 C434R probably damaging Het
Other mutations in Trpm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Trpm4 APN 7 45318349 missense probably benign
IGL01327:Trpm4 APN 7 45315073 missense probably damaging 1.00
IGL02069:Trpm4 APN 7 45319294 missense probably damaging 1.00
IGL02124:Trpm4 APN 7 45310523 missense probably damaging 1.00
IGL02141:Trpm4 APN 7 45318179 splice site probably null
IGL02333:Trpm4 APN 7 45322115 missense possibly damaging 0.85
IGL02338:Trpm4 APN 7 45326998 missense probably damaging 1.00
IGL02741:Trpm4 APN 7 45318488 missense possibly damaging 0.82
R0041:Trpm4 UTSW 7 45304946 critical splice donor site probably null
R0106:Trpm4 UTSW 7 45319240 critical splice donor site probably null
R0270:Trpm4 UTSW 7 45319253 missense possibly damaging 0.45
R0279:Trpm4 UTSW 7 45322048 missense probably damaging 0.99
R0309:Trpm4 UTSW 7 45308706 missense probably damaging 1.00
R0539:Trpm4 UTSW 7 45305472 missense probably damaging 0.99
R0969:Trpm4 UTSW 7 45327907 intron probably benign
R1454:Trpm4 UTSW 7 45317056 missense probably damaging 0.99
R1512:Trpm4 UTSW 7 45315044 missense probably benign 0.07
R1579:Trpm4 UTSW 7 45308597 missense probably damaging 1.00
R1768:Trpm4 UTSW 7 45308612 missense probably damaging 0.97
R2847:Trpm4 UTSW 7 45310598 missense probably damaging 1.00
R3884:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R4895:Trpm4 UTSW 7 45318058 missense probably damaging 0.98
R5056:Trpm4 UTSW 7 45308630 missense probably damaging 0.98
R5060:Trpm4 UTSW 7 45321834 missense probably damaging 1.00
R5069:Trpm4 UTSW 7 45310469 missense probably damaging 1.00
R5560:Trpm4 UTSW 7 45310332 missense probably damaging 1.00
R5783:Trpm4 UTSW 7 45310389 missense probably benign
R5874:Trpm4 UTSW 7 45327749 missense probably damaging 1.00
R6176:Trpm4 UTSW 7 45326676 missense probably damaging 1.00
R6302:Trpm4 UTSW 7 45327719 critical splice donor site probably null
R6431:Trpm4 UTSW 7 45326568 missense possibly damaging 0.79
R6762:Trpm4 UTSW 7 45304816 utr 3 prime probably benign
R6827:Trpm4 UTSW 7 45318628 missense possibly damaging 0.89
R6845:Trpm4 UTSW 7 45322329 missense possibly damaging 0.88
R6950:Trpm4 UTSW 7 45319280 missense probably damaging 0.97
R7126:Trpm4 UTSW 7 45310709 splice site probably null
R7159:Trpm4 UTSW 7 45327268 splice site probably null
R7167:Trpm4 UTSW 7 45327719 critical splice donor site probably null
R7386:Trpm4 UTSW 7 45314640 missense possibly damaging 0.47
R7516:Trpm4 UTSW 7 45305020 missense probably damaging 1.00
R7655:Trpm4 UTSW 7 45321809 missense probably benign 0.00
R7656:Trpm4 UTSW 7 45321809 missense probably benign 0.00
R7743:Trpm4 UTSW 7 45308338 missense probably benign 0.14
R8060:Trpm4 UTSW 7 45305451 missense probably damaging 1.00
X0018:Trpm4 UTSW 7 45314634 missense possibly damaging 0.61
X0022:Trpm4 UTSW 7 45310511 missense probably damaging 1.00
Z1177:Trpm4 UTSW 7 45326718 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAAGGCCCATCCTACCTTTC -3'
(R):5'- ATAGAGGATGCCACCCAAGC -3'

Sequencing Primer
(F):5'- GATAGTCTCAAACTCCTCGGAG -3'
(R):5'- AAGCTCAGCTCCCCTGC -3'
Posted On2015-04-17