Mutagenetix > Incidental Mutation

Incidental Mutation 'R3883:Neto2'

308824

Institutional Source

Beutler Lab

Gene Symbol

Neto2

Ensembl Gene

ENSMUSG00000036902

Gene Name

neuropilin (NRP) and tolloid (TLL)-like 2

Synonyms

MMRRC Submission

040796-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.140) question?

Stock #

R3883 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85636588-85700924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85663265 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 190 (S190P)

Ref Sequence

ENSEMBL: ENSMUSP00000150062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]

AlphaFold

Q8BNJ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000109686
AA Change: S218P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: S218P

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
CUB	80	194	2.56e-40	SMART
CUB	205	320	9.11e-5	SMART
LDLa	324	361	5.73e-5	SMART
transmembrane domain	374	396	N/A	INTRINSIC
coiled coil region	432	460	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209259

Predicted Effect

probably damaging
Transcript: ENSMUST00000209479
AA Change: S183P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215046

Predicted Effect

probably damaging
Transcript: ENSMUST00000216286
AA Change: S190P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.7999

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl1	C	T	8: 46,527,191	S423L	probably benign	Het
Ankmy1	T	G	1: 92,886,152	E435A	probably damaging	Het
Ano5	T	A	7: 51,566,304	M343K	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
C3	T	C	17: 57,217,173		probably null	Het
C530008M17Rik	T	A	5: 76,856,574	W261R	unknown	Het
Cdk17	T	C	10: 93,212,077		probably null	Het
Cntn2	A	G	1: 132,528,939	V123A	probably damaging	Het
Dchs1	A	G	7: 105,762,563	Y1449H	probably damaging	Het
Ddx42	T	A	11: 106,247,692	N772K	probably benign	Het
Dnah11	T	C	12: 117,978,453		probably benign	Het
Edn1	T	A	13: 42,301,906	F4L	probably benign	Het
Epb41l3	C	T	17: 69,274,116	R552*	probably null	Het
Epc1	T	C	18: 6,452,258	D267G	possibly damaging	Het
Fbxo22	A	T	9: 55,223,262	T169S	probably benign	Het
Fmnl1	A	G	11: 103,182,114	N144D	probably damaging	Het
Folh1	A	G	7: 86,775,656	L35P	possibly damaging	Het
Gm10220	A	C	5: 26,116,910	S255A	possibly damaging	Het
Gm15446	G	T	5: 109,940,447	V9L	probably damaging	Het
Hipk2	A	G	6: 38,699,265	L1011P	probably damaging	Het
Kif4-ps	G	T	12: 101,146,214	V201L	probably damaging	Het
Klk1b16	T	C	7: 44,139,463	V40A	possibly damaging	Het
Lgsn	C	A	1: 31,176,459	D3E	probably benign	Het
Mavs	T	C	2: 131,245,298	S239P	probably benign	Het
Mkl2	T	A	16: 13,401,458	V667D	probably damaging	Het
Mtrf1	A	G	14: 79,419,267	Y403C	probably damaging	Het
Mycbp2	A	C	14: 103,295,250	L390V	probably damaging	Het
Ngly1	A	G	14: 16,270,574	I195V	probably damaging	Het
Olfr1339	T	C	4: 118,734,685	I52T	probably benign	Het
Olfr961	A	G	9: 39,647,124	I133V	probably benign	Het
Pde4dip	T	C	3: 97,713,188	K1632E	probably damaging	Het
Pigk	T	C	3: 152,714,195	S21P	probably benign	Het
Rabggtb	A	G	3: 153,910,780	F82L	probably damaging	Het
Reep6	G	A	10: 80,335,535	R415Q	probably benign	Het
Serpinb13	T	C	1: 106,998,572	V159A	probably benign	Het
Slc5a8	T	A	10: 88,902,463	M196K	possibly damaging	Het
Sprr1a	G	A	3: 92,484,520	P58L	probably damaging	Het
Taf1a	A	T	1: 183,390,948	T10S	possibly damaging	Het
Tap1	T	A	17: 34,193,258	V479E	probably damaging	Het
Trpm4	C	T	7: 45,321,998		probably null	Het
Ush2a	T	C	1: 188,263,382	Y117H	probably benign	Het
Vmn2r58	A	T	7: 41,864,490	L243*	probably null	Het
Zbtb32	A	G	7: 30,591,144	I242T	probably benign	Het
Zbtb7a	T	C	10: 81,148,025	C434R	probably damaging	Het

Other mutations in Neto2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01705:Neto2	APN	8	85641003	missense	probably damaging	1.00
IGL01938:Neto2	APN	8	85690855	missense	probably benign	0.00
IGL02238:Neto2	APN	8	85669663	missense	probably damaging	0.99
IGL02605:Neto2	APN	8	85663435	splice site	probably benign
IGL02813:Neto2	APN	8	85690886	missense	probably benign
R0138:Neto2	UTSW	8	85641044	missense	possibly damaging	0.72
R1934:Neto2	UTSW	8	85670404	missense	possibly damaging	0.96
R2402:Neto2	UTSW	8	85690912	missense	probably benign	0.00
R2423:Neto2	UTSW	8	85669767	missense	probably damaging	1.00
R3821:Neto2	UTSW	8	85663295	nonsense	probably null
R3822:Neto2	UTSW	8	85663295	nonsense	probably null
R3939:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R3940:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R3941:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R4433:Neto2	UTSW	8	85641083	missense	probably damaging	1.00
R4668:Neto2	UTSW	8	85641062	missense	probably damaging	1.00
R4675:Neto2	UTSW	8	85669704	missense	probably damaging	1.00
R4908:Neto2	UTSW	8	85669764	missense	probably damaging	0.99
R5459:Neto2	UTSW	8	85670483	missense	probably benign	0.35
R5471:Neto2	UTSW	8	85640760	missense	probably benign	0.41
R5544:Neto2	UTSW	8	85647877	missense	possibly damaging	0.94
R5571:Neto2	UTSW	8	85640544	missense	probably damaging	1.00
R6083:Neto2	UTSW	8	85640585	missense	probably benign	0.00
R6339:Neto2	UTSW	8	85640558	missense	probably benign	0.33
R6381:Neto2	UTSW	8	85642509	missense	probably damaging	0.99
R6572:Neto2	UTSW	8	85670404	missense	possibly damaging	0.96
R6593:Neto2	UTSW	8	85669546	missense	probably damaging	1.00
R6662:Neto2	UTSW	8	85663215	missense	probably damaging	1.00
R6881:Neto2	UTSW	8	85640556	missense	probably damaging	1.00
R6950:Neto2	UTSW	8	85670443	missense	probably damaging	1.00
R7121:Neto2	UTSW	8	85670391	splice site	probably null
R7754:Neto2	UTSW	8	85669700	missense	probably damaging	0.98
R7755:Neto2	UTSW	8	85669656	missense	probably damaging	1.00
R8682:Neto2	UTSW	8	85640666	missense	probably benign	0.01
R9326:Neto2	UTSW	8	85642434	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGTGCCCAATACAGTAAAGG -3'
(R):5'- AAAGCTCAGTACCAATGACTTTCTCC -3'

Sequencing Primer
(F):5'- GCCCAATACAGTAAAGGAAACAAAAG -3'
(R):5'- CTCTCTTTTGTTACAGATCCAGAC -3'

Posted On

2015-04-17