Incidental Mutation 'R3883:Olfr961'
ID308825
Institutional Source Beutler Lab
Gene Symbol Olfr961
Ensembl Gene ENSMUSG00000059106
Gene Nameolfactory receptor 961
SynonymsMOR224-5, GA_x6K02T2PVTD-33343617-33344561
MMRRC Submission 040796-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R3883 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39645085-39649556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39647124 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 133 (I133V)
Ref Sequence ENSEMBL: ENSMUSP00000151840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076548] [ENSMUST00000219295]
Predicted Effect probably benign
Transcript: ENSMUST00000076548
AA Change: I133V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075863
Gene: ENSMUSG00000059106
AA Change: I133V

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.1e-50 PFAM
Pfam:7tm_1 39 286 4.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219295
AA Change: I133V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 C T 8: 46,527,191 S423L probably benign Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ano5 T A 7: 51,566,304 M343K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
C3 T C 17: 57,217,173 probably null Het
C530008M17Rik T A 5: 76,856,574 W261R unknown Het
Cdk17 T C 10: 93,212,077 probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Dchs1 A G 7: 105,762,563 Y1449H probably damaging Het
Ddx42 T A 11: 106,247,692 N772K probably benign Het
Dnah11 T C 12: 117,978,453 probably benign Het
Edn1 T A 13: 42,301,906 F4L probably benign Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Epc1 T C 18: 6,452,258 D267G possibly damaging Het
Fbxo22 A T 9: 55,223,262 T169S probably benign Het
Fmnl1 A G 11: 103,182,114 N144D probably damaging Het
Folh1 A G 7: 86,775,656 L35P possibly damaging Het
Gm10220 A C 5: 26,116,910 S255A possibly damaging Het
Gm15446 G T 5: 109,940,447 V9L probably damaging Het
Hipk2 A G 6: 38,699,265 L1011P probably damaging Het
Kif4-ps G T 12: 101,146,214 V201L probably damaging Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lgsn C A 1: 31,176,459 D3E probably benign Het
Mavs T C 2: 131,245,298 S239P probably benign Het
Mkl2 T A 16: 13,401,458 V667D probably damaging Het
Mtrf1 A G 14: 79,419,267 Y403C probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Neto2 A G 8: 85,663,265 S190P probably damaging Het
Ngly1 A G 14: 16,270,574 I195V probably damaging Het
Olfr1339 T C 4: 118,734,685 I52T probably benign Het
Pde4dip T C 3: 97,713,188 K1632E probably damaging Het
Pigk T C 3: 152,714,195 S21P probably benign Het
Rabggtb A G 3: 153,910,780 F82L probably damaging Het
Reep6 G A 10: 80,335,535 R415Q probably benign Het
Serpinb13 T C 1: 106,998,572 V159A probably benign Het
Slc5a8 T A 10: 88,902,463 M196K possibly damaging Het
Sprr1a G A 3: 92,484,520 P58L probably damaging Het
Taf1a A T 1: 183,390,948 T10S possibly damaging Het
Tap1 T A 17: 34,193,258 V479E probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ush2a T C 1: 188,263,382 Y117H probably benign Het
Vmn2r58 A T 7: 41,864,490 L243* probably null Het
Zbtb32 A G 7: 30,591,144 I242T probably benign Het
Zbtb7a T C 10: 81,148,025 C434R probably damaging Het
Other mutations in Olfr961
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Olfr961 APN 9 39647340 missense probably benign 0.19
IGL01792:Olfr961 APN 9 39647659 missense probably benign 0.07
R0344:Olfr961 UTSW 9 39647350 missense probably damaging 1.00
R0503:Olfr961 UTSW 9 39647476 missense probably damaging 1.00
R0525:Olfr961 UTSW 9 39647471 missense probably damaging 1.00
R0531:Olfr961 UTSW 9 39646872 missense probably benign
R1188:Olfr961 UTSW 9 39647476 missense probably damaging 1.00
R1453:Olfr961 UTSW 9 39647163 missense probably benign 0.01
R2970:Olfr961 UTSW 9 39646899 missense probably damaging 1.00
R4423:Olfr961 UTSW 9 39647116 missense probably damaging 1.00
R5129:Olfr961 UTSW 9 39647494 missense probably benign 0.03
R6148:Olfr961 UTSW 9 39647259 missense probably damaging 1.00
R6738:Olfr961 UTSW 9 39646661 start gained probably benign
R6778:Olfr961 UTSW 9 39646747 missense probably damaging 1.00
R7194:Olfr961 UTSW 9 39647091 missense probably benign 0.15
R7545:Olfr961 UTSW 9 39647107 missense probably damaging 0.97
RF008:Olfr961 UTSW 9 39647263 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GAAACCTCTCCATCTTTGACTTAGG -3'
(R):5'- TGTGAAACCTACCCTCTGTGC -3'

Sequencing Primer
(F):5'- TCTGTTCCACTACAGCTCCAAAGATG -3'
(R):5'- CTGTGCTAGAGAGGAATCTTCAC -3'
Posted On2015-04-17