Mutagenetix > Incidental Mutation

Incidental Mutation 'R3883:Mtrf1'

308839

Institutional Source

Beutler Lab

Gene Symbol

Mtrf1

Ensembl Gene

ENSMUSG00000022022

Gene Name

mitochondrial translational release factor 1

Synonyms

MMRRC Submission

040796-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R3883 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79397772-79423587 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79419267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 403 (Y403C)

Ref Sequence

ENSEMBL: ENSMUSP00000022600 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022600]

AlphaFold

Q8K126

Predicted Effect

probably damaging
Transcript: ENSMUST00000022600
AA Change: Y403C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022
AA Change: Y403C

Domain	Start	End	E-Value	Type
low complexity region	104	119	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
PCRF	139	255	5.96e-27	SMART
Pfam:RF-1	290	400	2.6e-41	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227610

Meta Mutation Damage Score

0.1723

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl1	C	T	8: 46,527,191	S423L	probably benign	Het
Ankmy1	T	G	1: 92,886,152	E435A	probably damaging	Het
Ano5	T	A	7: 51,566,304	M343K	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
C3	T	C	17: 57,217,173		probably null	Het
C530008M17Rik	T	A	5: 76,856,574	W261R	unknown	Het
Cdk17	T	C	10: 93,212,077		probably null	Het
Cntn2	A	G	1: 132,528,939	V123A	probably damaging	Het
Dchs1	A	G	7: 105,762,563	Y1449H	probably damaging	Het
Ddx42	T	A	11: 106,247,692	N772K	probably benign	Het
Dnah11	T	C	12: 117,978,453		probably benign	Het
Edn1	T	A	13: 42,301,906	F4L	probably benign	Het
Epb41l3	C	T	17: 69,274,116	R552*	probably null	Het
Epc1	T	C	18: 6,452,258	D267G	possibly damaging	Het
Fbxo22	A	T	9: 55,223,262	T169S	probably benign	Het
Fmnl1	A	G	11: 103,182,114	N144D	probably damaging	Het
Folh1	A	G	7: 86,775,656	L35P	possibly damaging	Het
Gm10220	A	C	5: 26,116,910	S255A	possibly damaging	Het
Gm15446	G	T	5: 109,940,447	V9L	probably damaging	Het
Hipk2	A	G	6: 38,699,265	L1011P	probably damaging	Het
Kif4-ps	G	T	12: 101,146,214	V201L	probably damaging	Het
Klk1b16	T	C	7: 44,139,463	V40A	possibly damaging	Het
Lgsn	C	A	1: 31,176,459	D3E	probably benign	Het
Mavs	T	C	2: 131,245,298	S239P	probably benign	Het
Mkl2	T	A	16: 13,401,458	V667D	probably damaging	Het
Mycbp2	A	C	14: 103,295,250	L390V	probably damaging	Het
Neto2	A	G	8: 85,663,265	S190P	probably damaging	Het
Ngly1	A	G	14: 16,270,574	I195V	probably damaging	Het
Olfr1339	T	C	4: 118,734,685	I52T	probably benign	Het
Olfr961	A	G	9: 39,647,124	I133V	probably benign	Het
Pde4dip	T	C	3: 97,713,188	K1632E	probably damaging	Het
Pigk	T	C	3: 152,714,195	S21P	probably benign	Het
Rabggtb	A	G	3: 153,910,780	F82L	probably damaging	Het
Reep6	G	A	10: 80,335,535	R415Q	probably benign	Het
Serpinb13	T	C	1: 106,998,572	V159A	probably benign	Het
Slc5a8	T	A	10: 88,902,463	M196K	possibly damaging	Het
Sprr1a	G	A	3: 92,484,520	P58L	probably damaging	Het
Taf1a	A	T	1: 183,390,948	T10S	possibly damaging	Het
Tap1	T	A	17: 34,193,258	V479E	probably damaging	Het
Trpm4	C	T	7: 45,321,998		probably null	Het
Ush2a	T	C	1: 188,263,382	Y117H	probably benign	Het
Vmn2r58	A	T	7: 41,864,490	L243*	probably null	Het
Zbtb32	A	G	7: 30,591,144	I242T	probably benign	Het
Zbtb7a	T	C	10: 81,148,025	C434R	probably damaging	Het

Other mutations in Mtrf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01356:Mtrf1	APN	14	79423425	missense	probably benign	0.10
IGL01478:Mtrf1	APN	14	79402920	splice site	probably benign
IGL01866:Mtrf1	APN	14	79401508	missense	probably benign
IGL02290:Mtrf1	APN	14	79401811	nonsense	probably null
IGL02929:Mtrf1	APN	14	79402833	missense	probably benign	0.00
IGL03342:Mtrf1	APN	14	79415980	missense	possibly damaging	0.80
IGL03342:Mtrf1	APN	14	79415871	splice site	probably benign
IGL03342:Mtrf1	APN	14	79415872	splice site	probably null
R0212:Mtrf1	UTSW	14	79419279	missense	probably benign	0.02
R0560:Mtrf1	UTSW	14	79406850	missense	probably damaging	1.00
R0604:Mtrf1	UTSW	14	79415887	missense	possibly damaging	0.92
R0669:Mtrf1	UTSW	14	79419268	nonsense	probably null
R0981:Mtrf1	UTSW	14	79401590	missense	probably benign	0.04
R1837:Mtrf1	UTSW	14	79401833	missense	possibly damaging	0.89
R1969:Mtrf1	UTSW	14	79401671	missense	probably damaging	1.00
R4739:Mtrf1	UTSW	14	79413080	missense	probably damaging	1.00
R4748:Mtrf1	UTSW	14	79411650	missense	probably damaging	1.00
R4780:Mtrf1	UTSW	14	79401688	missense	probably benign	0.02
R4965:Mtrf1	UTSW	14	79406587	missense	probably benign
R5616:Mtrf1	UTSW	14	79401445	missense	possibly damaging	0.68
R6530:Mtrf1	UTSW	14	79402891	missense	possibly damaging	0.89
R6776:Mtrf1	UTSW	14	79413081	missense	probably damaging	1.00
R7095:Mtrf1	UTSW	14	79423491	frame shift	probably null
R7182:Mtrf1	UTSW	14	79423464	missense	possibly damaging	0.60
R7254:Mtrf1	UTSW	14	79423491	frame shift	probably null
R7871:Mtrf1	UTSW	14	79406938	missense	probably benign	0.19
R8249:Mtrf1	UTSW	14	79401479	missense	probably benign	0.23
R9593:Mtrf1	UTSW	14	79419224	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TAGATATTTAATCCCCTCAAGCAGG -3'
(R):5'- CCTGCAGCAACATTTAGGGC -3'

Sequencing Primer
(F):5'- CTCAAGCAGGAAAATCAAGTATAA -3'
(R):5'- GCTAAGAGCAGCTTCTACCTG -3'

Posted On

2015-04-17