Incidental Mutation 'R0379:Serpinf1'
ID30884
Institutional Source Beutler Lab
Gene Symbol Serpinf1
Ensembl Gene ENSMUSG00000000753
Gene Nameserine (or cysteine) peptidase inhibitor, clade F, member 1
Synonymsalpha-2 antiplasmin, Pedfl, Pedf, pigment epithelium derived factor, EPC-1, Sdf3
MMRRC Submission 038585-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R0379 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location75409769-75422701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 75413945 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 197 (I197L)
Ref Sequence ENSEMBL: ENSMUSP00000121180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000769] [ENSMUST00000125982] [ENSMUST00000137103] [ENSMUST00000138661] [ENSMUST00000155009] [ENSMUST00000168902]
Predicted Effect probably benign
Transcript: ENSMUST00000000769
AA Change: I249L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000000769
Gene: ENSMUSG00000000753
AA Change: I249L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 62 414 5.22e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125982
SMART Domains Protein: ENSMUSP00000126807
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Serpin 55 147 4.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137103
SMART Domains Protein: ENSMUSP00000114761
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 62 210 7.93e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138661
AA Change: I197L

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121180
Gene: ENSMUSG00000000753
AA Change: I197L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 62 205 1.47e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139403
Predicted Effect probably benign
Transcript: ENSMUST00000155009
SMART Domains Protein: ENSMUSP00000131531
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:1IMV|A 27 64 2e-16 PDB
SCOP:d1imva_ 35 64 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167281
SMART Domains Protein: ENSMUSP00000133230
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
Pfam:Serpin 1 122 7.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168902
SMART Domains Protein: ENSMUSP00000131043
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin family that does not display the serine protease inhibitory activity shown by many of the other serpin proteins. The encoded protein is secreted and strongly inhibits angiogenesis. In addition, this protein is a neurotrophic factor involved in neuronal differentiation in retinoblastoma cells. Mutations in this gene were found in individuals with osteogenesis imperfecta, type VI. [provided by RefSeq, Aug 2016]
PHENOTYPE: Loss of function results in increased microvasculature, pancreatic enlargement, and prostatic hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,785,546 probably benign Het
4930512M02Rik A G 11: 11,589,365 probably benign Het
Apba1 A C 19: 23,934,830 N558T probably damaging Het
Arfgef2 T A 2: 166,860,400 probably null Het
Arsb T C 13: 93,940,627 S501P probably benign Het
Atp10b A G 11: 43,254,314 T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 R648L probably damaging Het
Bcl2a1b T C 9: 89,199,736 I126T possibly damaging Het
Brd9 T C 13: 73,942,683 probably benign Het
Cd93 T C 2: 148,441,510 probably benign Het
Chd5 A G 4: 152,383,321 K1692R probably benign Het
Clcn4 T C 7: 7,296,792 T13A probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Clec4g A G 8: 3,718,440 V97A probably benign Het
Col24a1 G A 3: 145,524,142 R1483K possibly damaging Het
Crem A T 18: 3,299,226 V82D probably damaging Het
Ctnna2 T A 6: 77,641,440 T180S probably benign Het
Cybrd1 T C 2: 71,129,755 I99T probably benign Het
Cyp4a32 G A 4: 115,621,474 V468M probably damaging Het
Dlk1 A G 12: 109,455,059 probably benign Het
Dnah7b A T 1: 46,140,176 Y1003F probably benign Het
Egfem1 A C 3: 29,668,250 E376A possibly damaging Het
Etl4 T A 2: 20,807,354 I1416K probably damaging Het
Fbxl4 A G 4: 22,386,106 T238A probably benign Het
Fer1l6 A G 15: 58,548,338 I33M probably benign Het
Fndc3a A G 14: 72,556,609 S830P probably damaging Het
Fras1 C T 5: 96,755,509 R3082* probably null Het
Galnt13 T C 2: 55,060,492 V395A possibly damaging Het
Gm10334 T G 6: 41,445,256 probably benign Het
Gpd2 C T 2: 57,345,263 T335I probably damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Hydin A G 8: 110,509,127 probably benign Het
Ints5 G T 19: 8,897,133 V819L possibly damaging Het
Klhdc10 C G 6: 30,450,670 Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,479 A67T probably benign Het
Lrp1 T G 10: 127,594,969 T404P probably damaging Het
March7 T C 2: 60,234,126 S249P probably benign Het
Mcm10 T A 2: 5,008,623 K66M probably benign Het
Mtmr7 C A 8: 40,551,601 D645Y probably damaging Het
Muc6 T A 7: 141,636,955 I2602F possibly damaging Het
Myh13 G A 11: 67,369,295 probably benign Het
Myo18a G A 11: 77,850,806 V1776I possibly damaging Het
Ncapg2 T C 12: 116,443,075 L957S probably damaging Het
Ncoa3 T C 2: 166,054,502 S442P probably damaging Het
Olfr1093 G A 2: 86,785,735 E2K probably benign Het
Olfr850 T A 9: 19,477,480 T257S possibly damaging Het
Olfr986 G A 9: 40,187,433 G106D probably damaging Het
Pdcd6 G T 13: 74,309,712 N113K possibly damaging Het
Pfkfb4 C T 9: 109,027,742 probably benign Het
Pfkm A G 15: 98,126,314 H401R probably benign Het
Phldb2 C A 16: 45,781,451 D754Y probably damaging Het
Plekhb2 T A 1: 34,863,114 M49K probably damaging Het
Polrmt A G 10: 79,737,611 S1057P possibly damaging Het
Prps1l1 A G 12: 34,985,078 N64S probably benign Het
Psg16 T C 7: 17,130,658 S393P probably benign Het
Rundc1 C T 11: 101,425,147 T15I probably benign Het
Scaf11 A G 15: 96,431,816 L143S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Siglec1 C T 2: 131,074,525 probably benign Het
Slc28a1 G A 7: 81,138,177 V271I probably benign Het
Sntg1 T C 1: 8,782,824 D34G probably damaging Het
Sptbn4 A T 7: 27,359,736 probably benign Het
Suclg1 T C 6: 73,256,228 I51T possibly damaging Het
Syne1 C T 10: 5,541,989 R9Q probably damaging Het
Trim47 T A 11: 116,106,518 H470L probably damaging Het
Ttc41 T A 10: 86,712,977 Y12N possibly damaging Het
Tubgcp2 T C 7: 140,032,192 E69G probably damaging Het
Tubgcp3 G A 8: 12,641,116 T474M probably damaging Het
Ubr5 A T 15: 38,018,957 N777K probably benign Het
Ush2a T C 1: 188,451,819 L1440P probably damaging Het
Usp28 A C 9: 49,024,067 D458A possibly damaging Het
Vcan A T 13: 89,703,546 D1098E probably damaging Het
Vmn1r73 C T 7: 11,756,846 T197I probably benign Het
Vmn2r15 T C 5: 109,286,478 S787G probably damaging Het
Vmn2r90 T A 17: 17,728,139 I549N probably damaging Het
Vps33b T A 7: 80,283,414 probably null Het
Zfp516 A T 18: 82,987,670 K900* probably null Het
Zfp974 T A 7: 27,910,932 N456I probably damaging Het
Other mutations in Serpinf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
clenched UTSW 11 75413905 critical splice donor site probably null
R0306:Serpinf1 UTSW 11 75413935 missense probably damaging 1.00
R1588:Serpinf1 UTSW 11 75410250 missense probably damaging 0.99
R1720:Serpinf1 UTSW 11 75413981 missense probably null 0.26
R1917:Serpinf1 UTSW 11 75411007 missense possibly damaging 0.72
R1961:Serpinf1 UTSW 11 75416419 missense probably benign 0.01
R4704:Serpinf1 UTSW 11 75411041 missense probably damaging 0.99
R5138:Serpinf1 UTSW 11 75415028 missense probably damaging 1.00
R5618:Serpinf1 UTSW 11 75410184 missense possibly damaging 0.47
R6327:Serpinf1 UTSW 11 75413905 critical splice donor site probably null
R7031:Serpinf1 UTSW 11 75410196 missense probably damaging 1.00
R7171:Serpinf1 UTSW 11 75417985 missense possibly damaging 0.88
R7436:Serpinf1 UTSW 11 75416316 missense probably benign 0.11
R8344:Serpinf1 UTSW 11 75415571 missense unknown
Predicted Primers PCR Primer
(F):5'- AAACCCATTCTCGTGACCTTGATCC -3'
(R):5'- ATGGTCTGTGCCACACATGCTG -3'

Sequencing Primer
(F):5'- CCCTGGGAGAATGAGTTCTGATAAC -3'
(R):5'- TTGCTGCTGACAGCTCAGG -3'
Posted On2013-04-24