Mutagenetix > Incidental Mutation

Incidental Mutation 'R3883:C3'

308845

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000024164

Gene Name

complement component 3

Synonyms

complement factor 3, acylation stimulating protein, Plp

MMRRC Submission

040796-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3883 (G1)

Quality Score

200

Status

Validated

Chromosome

Chromosomal Location

57203970-57228136 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 57217173 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000024988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024988] [ENSMUST00000177425]

AlphaFold

P01027

Predicted Effect

probably null
Transcript: ENSMUST00000024988

SMART Domains

Protein: ENSMUSP00000024988
Gene: ENSMUSG00000024164

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
Pfam:A2M_N	130	225	3.8e-17	PFAM
A2M_N_2	456	604	5.22e-38	SMART
ANATO	693	728	5.69e-15	SMART
low complexity region	752	762	N/A	INTRINSIC
A2M	770	866	5.47e-32	SMART
Pfam:Thiol-ester_cl	1000	1028	4.6e-15	PFAM
Pfam:A2M_comp	1051	1284	7.3e-60	PFAM
A2M_recep	1398	1493	3.98e-43	SMART
C345C	1533	1645	1.85e-48	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176457

Predicted Effect

probably benign
Transcript: ENSMUST00000177046

Predicted Effect

probably benign
Transcript: ENSMUST00000177425

SMART Domains

Protein: ENSMUSP00000135663
Gene: ENSMUSG00000024164

Domain	Start	End	E-Value	Type
Pfam:A2M_N_2	1	55	1.6e-10	PFAM
PDB:3L5N\|B	74	102	1e-9	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184453

Meta Mutation Damage Score

0.9351

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: This gene encodes complement protein C3 which plays a central role in the classical, alternative and lectin activation pathways of the complement system. The encoded preproprotein undergoes a multi-step processing to generate various functional peptides. Mice deficient in the encoded protein fail to clear bacteria from the blood stream upon infection, display diminished airway hyperresponsiveness and lung eosinophilia upon allergen-induced pulmonary allergy, and develop severe lung injury after deposition of IgG immune complexes. Deficiency of the homolog of the encoded protein in humans was found to be associated with increased susceptibility to infections, age-related macular degeneration, and atypical hemolytic uremic syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice exhibit abnormal immune responses, including increased mortality upon bacterial infection and decreased inflammatory response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl1	C	T	8: 46,527,191	S423L	probably benign	Het
Ankmy1	T	G	1: 92,886,152	E435A	probably damaging	Het
Ano5	T	A	7: 51,566,304	M343K	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
C530008M17Rik	T	A	5: 76,856,574	W261R	unknown	Het
Cdk17	T	C	10: 93,212,077		probably null	Het
Cntn2	A	G	1: 132,528,939	V123A	probably damaging	Het
Dchs1	A	G	7: 105,762,563	Y1449H	probably damaging	Het
Ddx42	T	A	11: 106,247,692	N772K	probably benign	Het
Dnah11	T	C	12: 117,978,453		probably benign	Het
Edn1	T	A	13: 42,301,906	F4L	probably benign	Het
Epb41l3	C	T	17: 69,274,116	R552*	probably null	Het
Epc1	T	C	18: 6,452,258	D267G	possibly damaging	Het
Fbxo22	A	T	9: 55,223,262	T169S	probably benign	Het
Fmnl1	A	G	11: 103,182,114	N144D	probably damaging	Het
Folh1	A	G	7: 86,775,656	L35P	possibly damaging	Het
Gm10220	A	C	5: 26,116,910	S255A	possibly damaging	Het
Gm15446	G	T	5: 109,940,447	V9L	probably damaging	Het
Hipk2	A	G	6: 38,699,265	L1011P	probably damaging	Het
Kif4-ps	G	T	12: 101,146,214	V201L	probably damaging	Het
Klk1b16	T	C	7: 44,139,463	V40A	possibly damaging	Het
Lgsn	C	A	1: 31,176,459	D3E	probably benign	Het
Mavs	T	C	2: 131,245,298	S239P	probably benign	Het
Mkl2	T	A	16: 13,401,458	V667D	probably damaging	Het
Mtrf1	A	G	14: 79,419,267	Y403C	probably damaging	Het
Mycbp2	A	C	14: 103,295,250	L390V	probably damaging	Het
Neto2	A	G	8: 85,663,265	S190P	probably damaging	Het
Ngly1	A	G	14: 16,270,574	I195V	probably damaging	Het
Olfr1339	T	C	4: 118,734,685	I52T	probably benign	Het
Olfr961	A	G	9: 39,647,124	I133V	probably benign	Het
Pde4dip	T	C	3: 97,713,188	K1632E	probably damaging	Het
Pigk	T	C	3: 152,714,195	S21P	probably benign	Het
Rabggtb	A	G	3: 153,910,780	F82L	probably damaging	Het
Reep6	G	A	10: 80,335,535	R415Q	probably benign	Het
Serpinb13	T	C	1: 106,998,572	V159A	probably benign	Het
Slc5a8	T	A	10: 88,902,463	M196K	possibly damaging	Het
Sprr1a	G	A	3: 92,484,520	P58L	probably damaging	Het
Taf1a	A	T	1: 183,390,948	T10S	possibly damaging	Het
Tap1	T	A	17: 34,193,258	V479E	probably damaging	Het
Trpm4	C	T	7: 45,321,998		probably null	Het
Ush2a	T	C	1: 188,263,382	Y117H	probably benign	Het
Vmn2r58	A	T	7: 41,864,490	L243*	probably null	Het
Zbtb32	A	G	7: 30,591,144	I242T	probably benign	Het
Zbtb7a	T	C	10: 81,148,025	C434R	probably damaging	Het

Other mutations in C3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:C3	APN	17	57226004	missense	probably benign	0.01
IGL00741:C3	APN	17	57220206	intron	probably benign
IGL01093:C3	APN	17	57223949	missense	probably damaging	1.00
IGL01309:C3	APN	17	57209652	intron	probably benign
IGL01312:C3	APN	17	57225993	unclassified	probably benign
IGL01344:C3	APN	17	57224880	missense	probably benign
IGL01514:C3	APN	17	57215866	missense	probably benign	0.04
IGL01913:C3	APN	17	57213767	missense	probably null	0.01
IGL02165:C3	APN	17	57225092	missense	probably benign	0.17
IGL02176:C3	APN	17	57226337	unclassified	probably benign
IGL02189:C3	APN	17	57220113	missense	probably benign	0.01
IGL02378:C3	APN	17	57212698	missense	probably benign	0.19
IGL02422:C3	APN	17	57226823	missense	probably damaging	0.98
IGL02715:C3	APN	17	57204158	intron	probably benign
IGL02737:C3	APN	17	57204281	missense	probably benign	0.08
IGL03201:C3	APN	17	57222249	missense	probably damaging	1.00
IGL03210:C3	APN	17	57215846	nonsense	probably null
IGL03345:C3	APN	17	57219585	missense	probably damaging	1.00
PIT4431001:C3	UTSW	17	57206242	missense	probably benign	0.00
PIT4494001:C3	UTSW	17	57209263	missense	probably benign	0.01
R0158:C3	UTSW	17	57224851	critical splice donor site	probably null
R0318:C3	UTSW	17	57224709	missense	probably damaging	0.99
R1132:C3	UTSW	17	57207531	critical splice donor site	probably null
R1765:C3	UTSW	17	57224401	splice site	probably null
R1793:C3	UTSW	17	57219592	missense	possibly damaging	0.93
R1852:C3	UTSW	17	57222823	missense	probably damaging	0.98
R1908:C3	UTSW	17	57209489	missense	probably damaging	1.00
R1919:C3	UTSW	17	57220135	missense	probably damaging	1.00
R1935:C3	UTSW	17	57218829	missense	probably damaging	1.00
R2026:C3	UTSW	17	57218562	missense	probably damaging	1.00
R2108:C3	UTSW	17	57223974	splice site	probably null
R2197:C3	UTSW	17	57219623	missense	probably benign	0.32
R2394:C3	UTSW	17	57222303	nonsense	probably null
R2998:C3	UTSW	17	57210284	missense	probably benign	0.00
R3727:C3	UTSW	17	57207379	missense	possibly damaging	0.50
R3767:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R3768:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R3769:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R3770:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R3784:C3	UTSW	17	57226067	missense	probably damaging	0.99
R3884:C3	UTSW	17	57217173	critical splice acceptor site	probably null
R3950:C3	UTSW	17	57225286	missense	probably benign	0.02
R3966:C3	UTSW	17	57218664	missense	probably damaging	0.99
R4077:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R4078:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R4079:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R4168:C3	UTSW	17	57218608	missense	probably benign	0.00
R4208:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R4695:C3	UTSW	17	57221057	missense	probably benign
R4909:C3	UTSW	17	57226830	critical splice donor site	probably null
R5011:C3	UTSW	17	57223236	missense	probably benign	0.06
R5094:C3	UTSW	17	57225033	critical splice donor site	probably null
R5141:C3	UTSW	17	57219570	missense	probably damaging	0.98
R5170:C3	UTSW	17	57223938	missense	probably damaging	0.96
R5339:C3	UTSW	17	57224308	missense	probably damaging	0.99
R5369:C3	UTSW	17	57221159	missense	probably benign	0.45
R5412:C3	UTSW	17	57220187	missense	probably benign	0.01
R5439:C3	UTSW	17	57204502	missense	probably benign	0.28
R5463:C3	UTSW	17	57211720	missense	probably benign	0.08
R5546:C3	UTSW	17	57222976	missense	probably damaging	0.99
R5572:C3	UTSW	17	57224673	missense	probably damaging	0.99
R5851:C3	UTSW	17	57211612	missense	probably null	0.14
R5863:C3	UTSW	17	57223141	missense	probably benign	0.06
R5888:C3	UTSW	17	57214831	missense	probably damaging	1.00
R5940:C3	UTSW	17	57210244	missense	possibly damaging	0.64
R6073:C3	UTSW	17	57206223	missense	probably null
R6091:C3	UTSW	17	57221967	nonsense	probably null
R6286:C3	UTSW	17	57224118	missense	probably damaging	1.00
R6524:C3	UTSW	17	57217264	critical splice donor site	probably null
R6868:C3	UTSW	17	57204029	missense	possibly damaging	0.55
R6896:C3	UTSW	17	57220864	splice site	probably null
R7007:C3	UTSW	17	57218809	missense	probably benign	0.00
R7022:C3	UTSW	17	57217286	missense	probably damaging	1.00
R7099:C3	UTSW	17	57206276	missense	probably benign	0.28
R7117:C3	UTSW	17	57212655	missense	probably benign	0.01
R7347:C3	UTSW	17	57223215	missense	probably benign	0.09
R7366:C3	UTSW	17	57221162	missense	probably benign	0.00
R7423:C3	UTSW	17	57214767	missense	probably damaging	1.00
R7425:C3	UTSW	17	57204039	missense	possibly damaging	0.81
R7481:C3	UTSW	17	57220136	missense	probably damaging	1.00
R7540:C3	UTSW	17	57206220	missense	probably benign	0.01
R7746:C3	UTSW	17	57218859	missense	probably damaging	1.00
R7771:C3	UTSW	17	57215797	missense	probably damaging	1.00
R7884:C3	UTSW	17	57226264	missense	probably benign	0.05
R8144:C3	UTSW	17	57226276	missense	probably damaging	0.98
R8279:C3	UTSW	17	57215809	missense	probably benign	0.28
R8284:C3	UTSW	17	57223938	missense	probably benign	0.39
R8328:C3	UTSW	17	57220973	missense	probably benign	0.00
R8353:C3	UTSW	17	57212643	missense	probably benign	0.00
R8396:C3	UTSW	17	57221029	missense	probably benign
R8429:C3	UTSW	17	57222811	missense	probably damaging	1.00
R8453:C3	UTSW	17	57212643	missense	probably benign	0.00
R8557:C3	UTSW	17	57224383	missense	probably benign	0.00
R8738:C3	UTSW	17	57204015	makesense	probably null
R8794:C3	UTSW	17	57221011	missense	probably benign
R9130:C3	UTSW	17	57211678	missense	probably damaging	1.00
R9296:C3	UTSW	17	57204291	missense	probably benign
R9432:C3	UTSW	17	57223950	missense	probably damaging	1.00
R9451:C3	UTSW	17	57224169	missense	probably benign	0.03
R9542:C3	UTSW	17	57225037	missense	probably damaging	1.00
R9615:C3	UTSW	17	57211669	missense	probably damaging	1.00
R9624:C3	UTSW	17	57220189	missense	probably benign	0.00
Z1177:C3	UTSW	17	57217144	missense	probably benign	0.07
Z1177:C3	UTSW	17	57226171	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCAAACAAGGCAGAGACTGT -3'
(R):5'- ATTTTATCCACCACCCTCCACAG -3'

Sequencing Primer
(F):5'- GCCCTCATTTTTCATAGGGGGAAAC -3'
(R):5'- TCCACAGCCAGAAGGAATG -3'

Posted On

2015-04-17