Incidental Mutation 'R3899:Stk32b'
ID 308861
Institutional Source Beutler Lab
Gene Symbol Stk32b
Ensembl Gene ENSMUSG00000029123
Gene Name serine/threonine kinase 32B
Synonyms YANK2, 2510009F08Rik, Stk32, STKG6
MMRRC Submission 040809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R3899 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 37446825-37717171 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37457154 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 337 (S337P)
Ref Sequence ENSEMBL: ENSMUSP00000092432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094836]
AlphaFold Q9JJX8
Predicted Effect probably damaging
Transcript: ENSMUST00000094836
AA Change: S337P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092432
Gene: ENSMUSG00000029123
AA Change: S337P

DomainStartEndE-ValueType
S_TKc 23 283 1.18e-84 SMART
low complexity region 323 336 N/A INTRINSIC
Meta Mutation Damage Score 0.2334 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-threonine protein kinase. Serine-threonine kinases transfer phosphate molecules to the oxygen atoms of serine and threonine. A genomic deletion affecting this gene has been associated with Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,557,237 probably benign Het
Ahctf1 A G 1: 179,777,780 S730P possibly damaging Het
Ankrd26 T A 6: 118,549,428 R327S probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apob A T 12: 8,015,849 I4273F possibly damaging Het
Ascl1 G T 10: 87,492,573 H172Q probably benign Het
Azi2 A G 9: 118,047,503 Y29C probably damaging Het
Baz1a A G 12: 54,934,804 M355T probably benign Het
BC027072 A T 17: 71,750,160 C841S probably benign Het
Brs3 G A X: 57,047,256 V367M possibly damaging Het
Ccdc33 T C 9: 58,032,917 D524G probably damaging Het
Cd300lf T C 11: 115,124,351 T138A probably damaging Het
Ces1g T C 8: 93,303,050 Y518C probably damaging Het
Chek2 C T 5: 110,865,613 probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cntnap2 A T 6: 45,991,903 H193L probably benign Het
Crim1 C A 17: 78,281,354 T286N probably benign Het
Cwc27 T A 13: 104,792,515 K307* probably null Het
Dbx2 T C 15: 95,632,432 D218G possibly damaging Het
Dclk1 G A 3: 55,247,329 R60Q probably damaging Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dpp10 A T 1: 123,353,557 W588R probably damaging Het
Epg5 G A 18: 77,957,510 E554K probably damaging Het
Eya1 T C 1: 14,270,747 T139A probably benign Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Foxd3 A G 4: 99,657,499 Y292C unknown Het
Gli1 C T 10: 127,336,666 M202I possibly damaging Het
Gm973 T C 1: 59,625,140 Y634H probably benign Het
Gpr132 G T 12: 112,852,108 A366E probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 C T 15: 66,030,523 M201I probably benign Het
Khdc3 T C 9: 73,104,346 probably benign Het
Lrrc37a A G 11: 103,497,546 V2351A unknown Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mtr A T 13: 12,216,849 N656K probably benign Het
Mtus1 T C 8: 41,083,129 T517A probably benign Het
Osgep G C 14: 50,924,743 N12K probably damaging Het
Prdx3 T A 19: 60,865,183 T235S probably benign Het
Rasa3 G A 8: 13,578,635 H608Y probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Slc30a5 T C 13: 100,818,147 M170V probably benign Het
Slc4a9 T C 18: 36,535,563 V732A probably benign Het
Slc7a2 C T 8: 40,905,553 T311M possibly damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Thop1 G A 10: 81,080,444 G429S probably damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Tmem2 A G 19: 21,852,234 T1236A probably benign Het
Tmem45a T C 16: 56,806,738 E256G probably damaging Het
Tox4 T A 14: 52,279,842 Y10N probably damaging Het
Trpm3 A G 19: 22,901,160 M642V possibly damaging Het
Ttll10 T C 4: 156,035,800 T508A probably damaging Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Vmn2r97 T C 17: 18,947,611 I709T probably damaging Het
Zcchc6 T A 13: 59,789,255 K791* probably null Het
Zfp936 T A 7: 43,189,734 N207K possibly damaging Het
Zfp946 T G 17: 22,454,550 I95S probably benign Het
Zhx3 A T 2: 160,780,451 S599T possibly damaging Het
Other mutations in Stk32b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Stk32b APN 5 37499030 splice site probably benign
IGL02525:Stk32b APN 5 37531633 missense probably damaging 1.00
IGL02946:Stk32b APN 5 37531539 splice site probably benign
IGL03277:Stk32b APN 5 37628976 missense probably damaging 0.99
flank UTSW 5 37466781 missense probably damaging 1.00
H8441:Stk32b UTSW 5 37457234 missense probably damaging 1.00
R0042:Stk32b UTSW 5 37716748 missense probably benign 0.09
R0042:Stk32b UTSW 5 37716748 missense probably benign 0.09
R0051:Stk32b UTSW 5 37459596 splice site probably benign
R0051:Stk32b UTSW 5 37459596 splice site probably benign
R0062:Stk32b UTSW 5 37461448 missense probably damaging 1.00
R0062:Stk32b UTSW 5 37461448 missense probably damaging 1.00
R0601:Stk32b UTSW 5 37531566 missense probably damaging 1.00
R0879:Stk32b UTSW 5 37459596 splice site probably benign
R1812:Stk32b UTSW 5 37466758 missense probably damaging 1.00
R1882:Stk32b UTSW 5 37531687 missense possibly damaging 0.91
R1982:Stk32b UTSW 5 37649114 missense probably damaging 0.99
R4724:Stk32b UTSW 5 37454934 critical splice donor site probably null
R4885:Stk32b UTSW 5 37466797 missense probably damaging 1.00
R5531:Stk32b UTSW 5 37459734 splice site probably null
R5629:Stk32b UTSW 5 37457232 missense probably damaging 1.00
R6042:Stk32b UTSW 5 37649114 missense probably damaging 0.99
R6610:Stk32b UTSW 5 37448678 missense probably benign 0.04
R6864:Stk32b UTSW 5 37448805 splice site probably null
R6879:Stk32b UTSW 5 37490523 missense possibly damaging 0.77
R7186:Stk32b UTSW 5 37466781 missense probably damaging 1.00
R8317:Stk32b UTSW 5 37454975 missense probably damaging 0.99
R8676:Stk32b UTSW 5 37457159 missense probably benign 0.00
R8795:Stk32b UTSW 5 37649139 missense probably damaging 0.98
R8948:Stk32b UTSW 5 37454997 missense possibly damaging 0.87
R9192:Stk32b UTSW 5 37629000 missense probably damaging 1.00
V1024:Stk32b UTSW 5 37457234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGAACAGCAATGTCCACCAC -3'
(R):5'- GTGAAGATGCCTGGGCTATG -3'

Sequencing Primer
(F):5'- CACCATTTTATACAAGGAGTGTGGG -3'
(R):5'- CTATGGGCAGAGGATGATGTGAC -3'
Posted On 2015-04-17