Incidental Mutation 'R3899:Fchsd2'
ID308867
Institutional Source Beutler Lab
Gene Symbol Fchsd2
Ensembl Gene ENSMUSG00000030691
Gene NameFCH and double SH3 domains 2
SynonymsSh3md3
MMRRC Submission 040809-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R3899 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101092863-101284405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101191799 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 172 (K172E)
Ref Sequence ENSEMBL: ENSMUSP00000146962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032931] [ENSMUST00000098250] [ENSMUST00000208439]
Predicted Effect probably benign
Transcript: ENSMUST00000032931
AA Change: K174E

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032931
Gene: ENSMUSG00000030691
AA Change: K174E

DomainStartEndE-ValueType
Pfam:FCH 21 103 1.3e-22 PFAM
coiled coil region 379 421 N/A INTRINSIC
low complexity region 466 474 N/A INTRINSIC
SH3 496 553 2.39e-14 SMART
low complexity region 554 569 N/A INTRINSIC
SH3 594 652 1.22e-20 SMART
low complexity region 676 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098250
AA Change: K174E

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095850
Gene: ENSMUSG00000030691
AA Change: K174E

DomainStartEndE-ValueType
Pfam:FCH 12 108 3.6e-23 PFAM
coiled coil region 355 397 N/A INTRINSIC
low complexity region 442 450 N/A INTRINSIC
SH3 472 529 2.39e-14 SMART
low complexity region 530 545 N/A INTRINSIC
SH3 570 628 1.22e-20 SMART
low complexity region 652 671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208063
Predicted Effect possibly damaging
Transcript: ENSMUST00000208439
AA Change: K172E

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.2902 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,557,237 probably benign Het
Ahctf1 A G 1: 179,777,780 S730P possibly damaging Het
Ankrd26 T A 6: 118,549,428 R327S probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apob A T 12: 8,015,849 I4273F possibly damaging Het
Ascl1 G T 10: 87,492,573 H172Q probably benign Het
Azi2 A G 9: 118,047,503 Y29C probably damaging Het
Baz1a A G 12: 54,934,804 M355T probably benign Het
BC027072 A T 17: 71,750,160 C841S probably benign Het
Brs3 G A X: 57,047,256 V367M possibly damaging Het
Ccdc33 T C 9: 58,032,917 D524G probably damaging Het
Cd300lf T C 11: 115,124,351 T138A probably damaging Het
Ces1g T C 8: 93,303,050 Y518C probably damaging Het
Chek2 C T 5: 110,865,613 probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cntnap2 A T 6: 45,991,903 H193L probably benign Het
Crim1 C A 17: 78,281,354 T286N probably benign Het
Cwc27 T A 13: 104,792,515 K307* probably null Het
Dbx2 T C 15: 95,632,432 D218G possibly damaging Het
Dclk1 G A 3: 55,247,329 R60Q probably damaging Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dpp10 A T 1: 123,353,557 W588R probably damaging Het
Epg5 G A 18: 77,957,510 E554K probably damaging Het
Eya1 T C 1: 14,270,747 T139A probably benign Het
Foxd3 A G 4: 99,657,499 Y292C unknown Het
Gli1 C T 10: 127,336,666 M202I possibly damaging Het
Gm973 T C 1: 59,625,140 Y634H probably benign Het
Gpr132 G T 12: 112,852,108 A366E probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 C T 15: 66,030,523 M201I probably benign Het
Khdc3 T C 9: 73,104,346 probably benign Het
Lrrc37a A G 11: 103,497,546 V2351A unknown Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mtr A T 13: 12,216,849 N656K probably benign Het
Mtus1 T C 8: 41,083,129 T517A probably benign Het
Osgep G C 14: 50,924,743 N12K probably damaging Het
Prdx3 T A 19: 60,865,183 T235S probably benign Het
Rasa3 G A 8: 13,578,635 H608Y probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Slc30a5 T C 13: 100,818,147 M170V probably benign Het
Slc4a9 T C 18: 36,535,563 V732A probably benign Het
Slc7a2 C T 8: 40,905,553 T311M possibly damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Stk32b A G 5: 37,457,154 S337P probably damaging Het
Thop1 G A 10: 81,080,444 G429S probably damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Tmem2 A G 19: 21,852,234 T1236A probably benign Het
Tmem45a T C 16: 56,806,738 E256G probably damaging Het
Tox4 T A 14: 52,279,842 Y10N probably damaging Het
Trpm3 A G 19: 22,901,160 M642V possibly damaging Het
Ttll10 T C 4: 156,035,800 T508A probably damaging Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Vmn2r97 T C 17: 18,947,611 I709T probably damaging Het
Zcchc6 T A 13: 59,789,255 K791* probably null Het
Zfp936 T A 7: 43,189,734 N207K possibly damaging Het
Zfp946 T G 17: 22,454,550 I95S probably benign Het
Zhx3 A T 2: 160,780,451 S599T possibly damaging Het
Other mutations in Fchsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Fchsd2 APN 7 101271622 missense probably benign 0.26
IGL00910:Fchsd2 APN 7 101277626 missense probably benign 0.00
IGL02065:Fchsd2 APN 7 101177222 critical splice donor site probably null
IGL02545:Fchsd2 APN 7 101198508 missense probably benign
IGL02651:Fchsd2 APN 7 101277600 missense possibly damaging 0.60
IGL03286:Fchsd2 APN 7 101259775 critical splice donor site probably null
IGL03333:Fchsd2 APN 7 101198496 missense probably damaging 0.97
R0066:Fchsd2 UTSW 7 101278424 missense possibly damaging 0.60
R0066:Fchsd2 UTSW 7 101278424 missense possibly damaging 0.60
R0668:Fchsd2 UTSW 7 101196920 missense possibly damaging 0.63
R1281:Fchsd2 UTSW 7 101253552 missense possibly damaging 0.92
R1868:Fchsd2 UTSW 7 101250438 splice site probably benign
R1996:Fchsd2 UTSW 7 101278453 missense probably benign 0.00
R2024:Fchsd2 UTSW 7 101198533 missense possibly damaging 0.81
R2060:Fchsd2 UTSW 7 101277417 missense probably benign
R2243:Fchsd2 UTSW 7 101233885 missense probably benign 0.30
R3419:Fchsd2 UTSW 7 101278660 splice site probably null
R3898:Fchsd2 UTSW 7 101191799 missense possibly damaging 0.90
R3900:Fchsd2 UTSW 7 101191799 missense possibly damaging 0.90
R4496:Fchsd2 UTSW 7 101282495 missense probably benign 0.09
R4569:Fchsd2 UTSW 7 101277602 missense possibly damaging 0.60
R4667:Fchsd2 UTSW 7 101250449 missense probably damaging 1.00
R5408:Fchsd2 UTSW 7 101271574 missense possibly damaging 0.82
R5449:Fchsd2 UTSW 7 101277524 missense probably damaging 1.00
R5543:Fchsd2 UTSW 7 101271699 missense probably damaging 1.00
R5665:Fchsd2 UTSW 7 101110784 missense possibly damaging 0.50
R5894:Fchsd2 UTSW 7 101191752 missense probably benign 0.08
R5936:Fchsd2 UTSW 7 101191701 missense probably damaging 1.00
R6243:Fchsd2 UTSW 7 101271809 critical splice acceptor site probably benign
R6244:Fchsd2 UTSW 7 101259776 splice site probably null
R6247:Fchsd2 UTSW 7 101253540 missense probably benign
R6932:Fchsd2 UTSW 7 101277414 nonsense probably null
R7250:Fchsd2 UTSW 7 101259685 missense possibly damaging 0.61
R7418:Fchsd2 UTSW 7 101271624 missense possibly damaging 0.56
R7469:Fchsd2 UTSW 7 101278656 critical splice donor site probably null
R7522:Fchsd2 UTSW 7 101259622 nonsense probably null
X0028:Fchsd2 UTSW 7 101110804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAAGACATATTGCACATAGAAC -3'
(R):5'- GCTGTCAATAAGCTCTCAAGTCTG -3'

Sequencing Primer
(F):5'- GCACATAGAACTCATTTTCTGTAAGC -3'
(R):5'- GCTCTCAAGTCTGTAAATCCAATG -3'
Posted On2015-04-17