Incidental Mutation 'R0379:Trim47'
ID30887
Institutional Source Beutler Lab
Gene Symbol Trim47
Ensembl Gene ENSMUSG00000020773
Gene Nametripartite motif-containing 47
Synonyms
MMRRC Submission 038585-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0379 (G1)
Quality Score222
Status Validated
Chromosome11
Chromosomal Location116105752-116127210 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116106518 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 470 (H470L)
Ref Sequence ENSEMBL: ENSMUSP00000102049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021120] [ENSMUST00000106441]
Predicted Effect probably damaging
Transcript: ENSMUST00000021120
AA Change: H471L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021120
Gene: ENSMUSG00000020773
AA Change: H471L

DomainStartEndE-ValueType
RING 9 57 3.14e-11 SMART
low complexity region 101 122 N/A INTRINSIC
BBOX 128 177 8.32e0 SMART
BBOX 181 221 1.76e-5 SMART
low complexity region 337 349 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
PRY 431 482 1.4e-2 SMART
Blast:SPRY 483 632 1e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106441
AA Change: H470L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102049
Gene: ENSMUSG00000020773
AA Change: H470L

DomainStartEndE-ValueType
RING 9 57 3.14e-11 SMART
low complexity region 101 122 N/A INTRINSIC
BBOX 128 177 8.32e0 SMART
BBOX 181 221 1.76e-5 SMART
low complexity region 337 349 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
PRY 430 481 1.4e-2 SMART
Pfam:SPRY 482 579 1.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149957
Meta Mutation Damage Score 0.1750 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,785,546 probably benign Het
4930512M02Rik A G 11: 11,589,365 probably benign Het
Apba1 A C 19: 23,934,830 N558T probably damaging Het
Arfgef2 T A 2: 166,860,400 probably null Het
Arsb T C 13: 93,940,627 S501P probably benign Het
Atp10b A G 11: 43,254,314 T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 R648L probably damaging Het
Bcl2a1b T C 9: 89,199,736 I126T possibly damaging Het
Brd9 T C 13: 73,942,683 probably benign Het
Cd93 T C 2: 148,441,510 probably benign Het
Chd5 A G 4: 152,383,321 K1692R probably benign Het
Clcn4 T C 7: 7,296,792 T13A probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Clec4g A G 8: 3,718,440 V97A probably benign Het
Col24a1 G A 3: 145,524,142 R1483K possibly damaging Het
Crem A T 18: 3,299,226 V82D probably damaging Het
Ctnna2 T A 6: 77,641,440 T180S probably benign Het
Cybrd1 T C 2: 71,129,755 I99T probably benign Het
Cyp4a32 G A 4: 115,621,474 V468M probably damaging Het
Dlk1 A G 12: 109,455,059 probably benign Het
Dnah7b A T 1: 46,140,176 Y1003F probably benign Het
Egfem1 A C 3: 29,668,250 E376A possibly damaging Het
Etl4 T A 2: 20,807,354 I1416K probably damaging Het
Fbxl4 A G 4: 22,386,106 T238A probably benign Het
Fer1l6 A G 15: 58,548,338 I33M probably benign Het
Fndc3a A G 14: 72,556,609 S830P probably damaging Het
Fras1 C T 5: 96,755,509 R3082* probably null Het
Galnt13 T C 2: 55,060,492 V395A possibly damaging Het
Gm10334 T G 6: 41,445,256 probably benign Het
Gpd2 C T 2: 57,345,263 T335I probably damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Hydin A G 8: 110,509,127 probably benign Het
Ints5 G T 19: 8,897,133 V819L possibly damaging Het
Klhdc10 C G 6: 30,450,670 Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,479 A67T probably benign Het
Lrp1 T G 10: 127,594,969 T404P probably damaging Het
March7 T C 2: 60,234,126 S249P probably benign Het
Mcm10 T A 2: 5,008,623 K66M probably benign Het
Mtmr7 C A 8: 40,551,601 D645Y probably damaging Het
Muc6 T A 7: 141,636,955 I2602F possibly damaging Het
Myh13 G A 11: 67,369,295 probably benign Het
Myo18a G A 11: 77,850,806 V1776I possibly damaging Het
Ncapg2 T C 12: 116,443,075 L957S probably damaging Het
Ncoa3 T C 2: 166,054,502 S442P probably damaging Het
Olfr1093 G A 2: 86,785,735 E2K probably benign Het
Olfr850 T A 9: 19,477,480 T257S possibly damaging Het
Olfr986 G A 9: 40,187,433 G106D probably damaging Het
Pdcd6 G T 13: 74,309,712 N113K possibly damaging Het
Pfkfb4 C T 9: 109,027,742 probably benign Het
Pfkm A G 15: 98,126,314 H401R probably benign Het
Phldb2 C A 16: 45,781,451 D754Y probably damaging Het
Plekhb2 T A 1: 34,863,114 M49K probably damaging Het
Polrmt A G 10: 79,737,611 S1057P possibly damaging Het
Prps1l1 A G 12: 34,985,078 N64S probably benign Het
Psg16 T C 7: 17,130,658 S393P probably benign Het
Rundc1 C T 11: 101,425,147 T15I probably benign Het
Scaf11 A G 15: 96,431,816 L143S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpinf1 T G 11: 75,413,945 I197L probably benign Het
Siglec1 C T 2: 131,074,525 probably benign Het
Slc28a1 G A 7: 81,138,177 V271I probably benign Het
Sntg1 T C 1: 8,782,824 D34G probably damaging Het
Sptbn4 A T 7: 27,359,736 probably benign Het
Suclg1 T C 6: 73,256,228 I51T possibly damaging Het
Syne1 C T 10: 5,541,989 R9Q probably damaging Het
Ttc41 T A 10: 86,712,977 Y12N possibly damaging Het
Tubgcp2 T C 7: 140,032,192 E69G probably damaging Het
Tubgcp3 G A 8: 12,641,116 T474M probably damaging Het
Ubr5 A T 15: 38,018,957 N777K probably benign Het
Ush2a T C 1: 188,451,819 L1440P probably damaging Het
Usp28 A C 9: 49,024,067 D458A possibly damaging Het
Vcan A T 13: 89,703,546 D1098E probably damaging Het
Vmn1r73 C T 7: 11,756,846 T197I probably benign Het
Vmn2r15 T C 5: 109,286,478 S787G probably damaging Het
Vmn2r90 T A 17: 17,728,139 I549N probably damaging Het
Vps33b T A 7: 80,283,414 probably null Het
Zfp516 A T 18: 82,987,670 K900* probably null Het
Zfp974 T A 7: 27,910,932 N456I probably damaging Het
Other mutations in Trim47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trim47 APN 11 116106194 missense probably damaging 1.00
IGL02040:Trim47 APN 11 116107908 missense probably damaging 1.00
IGL02419:Trim47 APN 11 116106201 missense probably damaging 1.00
IGL03329:Trim47 APN 11 116106428 missense probably damaging 1.00
trix UTSW 11 116107957 missense probably benign
R0190:Trim47 UTSW 11 116106227 missense probably damaging 1.00
R0523:Trim47 UTSW 11 116107890 missense probably damaging 1.00
R0671:Trim47 UTSW 11 116108352 missense probably benign
R1730:Trim47 UTSW 11 116106038 missense probably damaging 1.00
R1778:Trim47 UTSW 11 116109820 missense probably damaging 1.00
R1862:Trim47 UTSW 11 116106137 missense probably damaging 1.00
R1901:Trim47 UTSW 11 116107779 missense probably damaging 1.00
R2054:Trim47 UTSW 11 116108283 missense probably benign 0.43
R2081:Trim47 UTSW 11 116106413 missense probably damaging 1.00
R2099:Trim47 UTSW 11 116106344 missense probably damaging 1.00
R3832:Trim47 UTSW 11 116107957 missense probably benign
R4948:Trim47 UTSW 11 116106092 missense probably damaging 1.00
R5097:Trim47 UTSW 11 116106434 missense probably benign 0.38
R5148:Trim47 UTSW 11 116107852 missense possibly damaging 0.89
R7585:Trim47 UTSW 11 116107557 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTCCGTCTCGGACAGCATAG -3'
(R):5'- AGCTGCTAGGCTTCAGAAACAGGG -3'

Sequencing Primer
(F):5'- AGGGCATGGTCTGCATACTC -3'
(R):5'- GGGAACAATCTCTAAATTGAGCCTG -3'
Posted On2013-04-24