Incidental Mutation 'R3899:Thop1'
ID308881
Institutional Source Beutler Lab
Gene Symbol Thop1
Ensembl Gene ENSMUSG00000004929
Gene Namethimet oligopeptidase 1
SynonymsEP24.15
MMRRC Submission 040809-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R3899 (G1)
Quality Score131
Status Validated
Chromosome10
Chromosomal Location81070035-81082559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81080444 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 429 (G429S)
Ref Sequence ENSEMBL: ENSMUSP00000005057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005057] [ENSMUST00000117422]
Predicted Effect probably damaging
Transcript: ENSMUST00000005057
AA Change: G429S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005057
Gene: ENSMUSG00000004929
AA Change: G429S

DomainStartEndE-ValueType
Pfam:Peptidase_M3 227 677 7e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117422
SMART Domains Protein: ENSMUSP00000112836
Gene: ENSMUSG00000035041

DomainStartEndE-ValueType
low complexity region 179 199 N/A INTRINSIC
BRLZ 237 301 4.36e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171484
Meta Mutation Damage Score 0.6995 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kininase that uses zinc as a cofactor. The encoded oligopeptidase cleaves cytosolic peptides, making them unavailable for display on antigen-presenting cells. This protein also cleaves neuropeptides under 20 aa in length and can degrade beta-amyloid precursor protein to amyloidogenic peptides. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,557,237 probably benign Het
Ahctf1 A G 1: 179,777,780 S730P possibly damaging Het
Ankrd26 T A 6: 118,549,428 R327S probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apob A T 12: 8,015,849 I4273F possibly damaging Het
Ascl1 G T 10: 87,492,573 H172Q probably benign Het
Azi2 A G 9: 118,047,503 Y29C probably damaging Het
Baz1a A G 12: 54,934,804 M355T probably benign Het
BC027072 A T 17: 71,750,160 C841S probably benign Het
Brs3 G A X: 57,047,256 V367M possibly damaging Het
Ccdc33 T C 9: 58,032,917 D524G probably damaging Het
Cd300lf T C 11: 115,124,351 T138A probably damaging Het
Ces1g T C 8: 93,303,050 Y518C probably damaging Het
Chek2 C T 5: 110,865,613 probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cntnap2 A T 6: 45,991,903 H193L probably benign Het
Crim1 C A 17: 78,281,354 T286N probably benign Het
Cwc27 T A 13: 104,792,515 K307* probably null Het
Dbx2 T C 15: 95,632,432 D218G possibly damaging Het
Dclk1 G A 3: 55,247,329 R60Q probably damaging Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dpp10 A T 1: 123,353,557 W588R probably damaging Het
Epg5 G A 18: 77,957,510 E554K probably damaging Het
Eya1 T C 1: 14,270,747 T139A probably benign Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Foxd3 A G 4: 99,657,499 Y292C unknown Het
Gli1 C T 10: 127,336,666 M202I possibly damaging Het
Gm973 T C 1: 59,625,140 Y634H probably benign Het
Gpr132 G T 12: 112,852,108 A366E probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 C T 15: 66,030,523 M201I probably benign Het
Khdc3 T C 9: 73,104,346 probably benign Het
Lrrc37a A G 11: 103,497,546 V2351A unknown Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mtr A T 13: 12,216,849 N656K probably benign Het
Mtus1 T C 8: 41,083,129 T517A probably benign Het
Osgep G C 14: 50,924,743 N12K probably damaging Het
Prdx3 T A 19: 60,865,183 T235S probably benign Het
Rasa3 G A 8: 13,578,635 H608Y probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Slc30a5 T C 13: 100,818,147 M170V probably benign Het
Slc4a9 T C 18: 36,535,563 V732A probably benign Het
Slc7a2 C T 8: 40,905,553 T311M possibly damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Stk32b A G 5: 37,457,154 S337P probably damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Tmem2 A G 19: 21,852,234 T1236A probably benign Het
Tmem45a T C 16: 56,806,738 E256G probably damaging Het
Tox4 T A 14: 52,279,842 Y10N probably damaging Het
Trpm3 A G 19: 22,901,160 M642V possibly damaging Het
Ttll10 T C 4: 156,035,800 T508A probably damaging Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Vmn2r97 T C 17: 18,947,611 I709T probably damaging Het
Zcchc6 T A 13: 59,789,255 K791* probably null Het
Zfp936 T A 7: 43,189,734 N207K possibly damaging Het
Zfp946 T G 17: 22,454,550 I95S probably benign Het
Zhx3 A T 2: 160,780,451 S599T possibly damaging Het
Other mutations in Thop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Thop1 APN 10 81078599 nonsense probably null
IGL00987:Thop1 APN 10 81081695 missense probably damaging 0.99
R0241:Thop1 UTSW 10 81080245 unclassified probably benign
R0842:Thop1 UTSW 10 81075577 missense probably damaging 1.00
R1800:Thop1 UTSW 10 81073209 missense probably damaging 1.00
R1863:Thop1 UTSW 10 81073317 missense probably damaging 0.98
R2507:Thop1 UTSW 10 81070264 start codon destroyed probably null 0.47
R2905:Thop1 UTSW 10 81079591 missense probably damaging 1.00
R2930:Thop1 UTSW 10 81073314 missense probably damaging 0.98
R3898:Thop1 UTSW 10 81080444 missense probably damaging 1.00
R4911:Thop1 UTSW 10 81073291 missense probably damaging 1.00
R4924:Thop1 UTSW 10 81080194 missense probably benign 0.11
R4926:Thop1 UTSW 10 81073367 critical splice donor site probably null
R5092:Thop1 UTSW 10 81080578 missense probably damaging 1.00
R5968:Thop1 UTSW 10 81075559 missense probably benign 0.07
R6370:Thop1 UTSW 10 81077983 missense probably benign 0.00
R6733:Thop1 UTSW 10 81081412 missense probably damaging 0.98
R6853:Thop1 UTSW 10 81075661 critical splice donor site probably null
R7355:Thop1 UTSW 10 81075631 missense probably damaging 1.00
R7750:Thop1 UTSW 10 81080191 missense probably benign
R8030:Thop1 UTSW 10 81075616 missense possibly damaging 0.91
R8070:Thop1 UTSW 10 81079486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTATACCCCAGGTGAGAATG -3'
(R):5'- TGCCCTCACACCAAGTTAGC -3'

Sequencing Primer
(F):5'- TGAGAATGGGGCCCTGC -3'
(R):5'- GCTGGCGAGGAGTGATCTC -3'
Posted On2015-04-17