Incidental Mutation 'R0379:Clec14a'
ID30889
Institutional Source Beutler Lab
Gene Symbol Clec14a
Ensembl Gene ENSMUSG00000045930
Gene NameC-type lectin domain family 14, member a
Synonyms
MMRRC Submission 038585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R0379 (G1)
Quality Score205
Status Validated
Chromosome12
Chromosomal Location58264720-58269290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58268794 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 14 (F14S)
Ref Sequence ENSEMBL: ENSMUSP00000054451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062254
AA Change: F14S

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054451
Gene: ENSMUSG00000045930
AA Change: F14S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 31 172 1.4e-5 SMART
EGF 246 288 1.85e0 SMART
transmembrane domain 388 410 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. This family member plays a role in cell-cell adhesion and angiogenesis. It functions in filopodia formation, cell migration and tube formation. Due to its presence at higher levels in tumor endothelium than in normal tissue endothelium, it is considered to be a candidate for tumor vascular targeting. [provided by RefSeq, Jan 2012]
PHENOTYPE: No notable pheontype was detected in a high-throughput screen of homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,785,546 probably benign Het
4930512M02Rik A G 11: 11,589,365 probably benign Het
Apba1 A C 19: 23,934,830 N558T probably damaging Het
Arfgef2 T A 2: 166,860,400 probably null Het
Arsb T C 13: 93,940,627 S501P probably benign Het
Atp10b A G 11: 43,254,314 T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 R648L probably damaging Het
Bcl2a1b T C 9: 89,199,736 I126T possibly damaging Het
Brd9 T C 13: 73,942,683 probably benign Het
Cd93 T C 2: 148,441,510 probably benign Het
Chd5 A G 4: 152,383,321 K1692R probably benign Het
Clcn4 T C 7: 7,296,792 T13A probably damaging Het
Clec4g A G 8: 3,718,440 V97A probably benign Het
Col24a1 G A 3: 145,524,142 R1483K possibly damaging Het
Crem A T 18: 3,299,226 V82D probably damaging Het
Ctnna2 T A 6: 77,641,440 T180S probably benign Het
Cybrd1 T C 2: 71,129,755 I99T probably benign Het
Cyp4a32 G A 4: 115,621,474 V468M probably damaging Het
Dlk1 A G 12: 109,455,059 probably benign Het
Dnah7b A T 1: 46,140,176 Y1003F probably benign Het
Egfem1 A C 3: 29,668,250 E376A possibly damaging Het
Etl4 T A 2: 20,807,354 I1416K probably damaging Het
Fbxl4 A G 4: 22,386,106 T238A probably benign Het
Fer1l6 A G 15: 58,548,338 I33M probably benign Het
Fndc3a A G 14: 72,556,609 S830P probably damaging Het
Fras1 C T 5: 96,755,509 R3082* probably null Het
Galnt13 T C 2: 55,060,492 V395A possibly damaging Het
Gm10334 T G 6: 41,445,256 probably benign Het
Gpd2 C T 2: 57,345,263 T335I probably damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Hydin A G 8: 110,509,127 probably benign Het
Ints5 G T 19: 8,897,133 V819L possibly damaging Het
Klhdc10 C G 6: 30,450,670 Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,479 A67T probably benign Het
Lrp1 T G 10: 127,594,969 T404P probably damaging Het
March7 T C 2: 60,234,126 S249P probably benign Het
Mcm10 T A 2: 5,008,623 K66M probably benign Het
Mtmr7 C A 8: 40,551,601 D645Y probably damaging Het
Muc6 T A 7: 141,636,955 I2602F possibly damaging Het
Myh13 G A 11: 67,369,295 probably benign Het
Myo18a G A 11: 77,850,806 V1776I possibly damaging Het
Ncapg2 T C 12: 116,443,075 L957S probably damaging Het
Ncoa3 T C 2: 166,054,502 S442P probably damaging Het
Olfr1093 G A 2: 86,785,735 E2K probably benign Het
Olfr850 T A 9: 19,477,480 T257S possibly damaging Het
Olfr986 G A 9: 40,187,433 G106D probably damaging Het
Pdcd6 G T 13: 74,309,712 N113K possibly damaging Het
Pfkfb4 C T 9: 109,027,742 probably benign Het
Pfkm A G 15: 98,126,314 H401R probably benign Het
Phldb2 C A 16: 45,781,451 D754Y probably damaging Het
Plekhb2 T A 1: 34,863,114 M49K probably damaging Het
Polrmt A G 10: 79,737,611 S1057P possibly damaging Het
Prps1l1 A G 12: 34,985,078 N64S probably benign Het
Psg16 T C 7: 17,130,658 S393P probably benign Het
Rundc1 C T 11: 101,425,147 T15I probably benign Het
Scaf11 A G 15: 96,431,816 L143S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpinf1 T G 11: 75,413,945 I197L probably benign Het
Siglec1 C T 2: 131,074,525 probably benign Het
Slc28a1 G A 7: 81,138,177 V271I probably benign Het
Sntg1 T C 1: 8,782,824 D34G probably damaging Het
Sptbn4 A T 7: 27,359,736 probably benign Het
Suclg1 T C 6: 73,256,228 I51T possibly damaging Het
Syne1 C T 10: 5,541,989 R9Q probably damaging Het
Trim47 T A 11: 116,106,518 H470L probably damaging Het
Ttc41 T A 10: 86,712,977 Y12N possibly damaging Het
Tubgcp2 T C 7: 140,032,192 E69G probably damaging Het
Tubgcp3 G A 8: 12,641,116 T474M probably damaging Het
Ubr5 A T 15: 38,018,957 N777K probably benign Het
Ush2a T C 1: 188,451,819 L1440P probably damaging Het
Usp28 A C 9: 49,024,067 D458A possibly damaging Het
Vcan A T 13: 89,703,546 D1098E probably damaging Het
Vmn1r73 C T 7: 11,756,846 T197I probably benign Het
Vmn2r15 T C 5: 109,286,478 S787G probably damaging Het
Vmn2r90 T A 17: 17,728,139 I549N probably damaging Het
Vps33b T A 7: 80,283,414 probably null Het
Zfp516 A T 18: 82,987,670 K900* probably null Het
Zfp974 T A 7: 27,910,932 N456I probably damaging Het
Other mutations in Clec14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Clec14a APN 12 58268318 missense probably damaging 1.00
IGL02109:Clec14a APN 12 58268148 missense probably benign 0.00
IGL02121:Clec14a APN 12 58268437 missense probably damaging 1.00
IGL02136:Clec14a APN 12 58268629 missense probably damaging 1.00
IGL02818:Clec14a APN 12 58268102 missense probably damaging 1.00
R0382:Clec14a UTSW 12 58268617 missense probably damaging 1.00
R0419:Clec14a UTSW 12 58267665 missense probably damaging 0.97
R2972:Clec14a UTSW 12 58267574 missense probably damaging 1.00
R3796:Clec14a UTSW 12 58267909 missense probably benign 0.34
R3797:Clec14a UTSW 12 58267909 missense probably benign 0.34
R3876:Clec14a UTSW 12 58268644 missense possibly damaging 0.79
R4602:Clec14a UTSW 12 58267981 missense probably benign 0.03
R4708:Clec14a UTSW 12 58267703 missense probably benign 0.00
R4994:Clec14a UTSW 12 58268284 missense probably damaging 1.00
R5193:Clec14a UTSW 12 58268614 missense probably damaging 1.00
R5489:Clec14a UTSW 12 58268249 missense probably damaging 1.00
R5671:Clec14a UTSW 12 58267826 missense probably benign 0.05
R6318:Clec14a UTSW 12 58268215 missense probably damaging 1.00
R6388:Clec14a UTSW 12 58267457 makesense probably null
R6828:Clec14a UTSW 12 58268504 missense probably damaging 1.00
R7065:Clec14a UTSW 12 58268794 missense possibly damaging 0.90
R7418:Clec14a UTSW 12 58268647 missense probably damaging 0.99
R7635:Clec14a UTSW 12 58268528 missense probably damaging 1.00
R7666:Clec14a UTSW 12 58267757 missense probably benign 0.05
R7908:Clec14a UTSW 12 58267679 missense possibly damaging 0.63
X0024:Clec14a UTSW 12 58268326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAACTCCGAGCCTGAGTGC -3'
(R):5'- CTCTGGGACACATTTCCTGTCACG -3'

Sequencing Primer
(F):5'- TTGAAGGTAGCGTGGTGAAG -3'
(R):5'- TTGGAGGATGAGGGCTCAAG -3'
Posted On2013-04-24