Incidental Mutation 'R0379:Dlk1'
ID30890
Institutional Source Beutler Lab
Gene Symbol Dlk1
Ensembl Gene ENSMUSG00000040856
Gene Namedelta like non-canonical Notch ligand 1
SynonymspG2, SCP1, ZOG, FA1, Peg9, pref-1, DlkI
MMRRC Submission 038585-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.795) question?
Stock #R0379 (G1)
Quality Score215
Status Validated
Chromosome12
Chromosomal Location109452823-109463336 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 109455059 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000056110] [ENSMUST00000109841] [ENSMUST00000109842] [ENSMUST00000109843] [ENSMUST00000109844] [ENSMUST00000109846] [ENSMUST00000124293] [ENSMUST00000173539]
Predicted Effect probably benign
Transcript: ENSMUST00000056110
SMART Domains Protein: ENSMUSP00000063104
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
EGF 213 247 4.06e-6 SMART
transmembrane domain 307 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109841
SMART Domains Protein: ENSMUSP00000105467
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109842
SMART Domains Protein: ENSMUSP00000105468
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109843
SMART Domains Protein: ENSMUSP00000105469
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 212 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109844
SMART Domains Protein: ENSMUSP00000105470
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
EGF 213 247 4.06e-6 SMART
transmembrane domain 307 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109846
SMART Domains Protein: ENSMUSP00000105472
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 256 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124293
SMART Domains Protein: ENSMUSP00000133530
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
EGF 24 54 1.43e-1 SMART
EGF 55 85 1.26e-2 SMART
EGF_CA 87 124 1.77e-6 SMART
EGF 129 167 8.71e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173539
SMART Domains Protein: ENSMUSP00000133430
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 232 254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173812
SMART Domains Protein: ENSMUSP00000134308
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
SCOP:d1eqga2 2 15 4e-3 SMART
transmembrane domain 44 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174539
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains multiple epidermal growth factor repeats that functions as a regulator of cell growth. The encoded protein is involved in the differentiation of several cell types including adipocytes. This gene is located in a region of chromosome 14 frequently showing unparental disomy, and is imprinted and expressed from the paternal allele. A single nucleotide variant in this gene is associated with child and adolescent obesity and shows polar overdominance, where heterozygotes carrying an active paternal allele express the phenotype, while mutant homozygotes are normal. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygote null mice have reduced fetal growth and 50% lethality 2 days after birth. Survivors are small but have enlarged fat pad masses. Homozygotes for another null allele have abnormal B cell development. Paternally-inherited null alleles phenocopy homozygotes due to maternal imprinting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,785,546 probably benign Het
4930512M02Rik A G 11: 11,589,365 probably benign Het
Apba1 A C 19: 23,934,830 N558T probably damaging Het
Arfgef2 T A 2: 166,860,400 probably null Het
Arsb T C 13: 93,940,627 S501P probably benign Het
Atp10b A G 11: 43,254,314 T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 R648L probably damaging Het
Bcl2a1b T C 9: 89,199,736 I126T possibly damaging Het
Brd9 T C 13: 73,942,683 probably benign Het
Cd93 T C 2: 148,441,510 probably benign Het
Chd5 A G 4: 152,383,321 K1692R probably benign Het
Clcn4 T C 7: 7,296,792 T13A probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Clec4g A G 8: 3,718,440 V97A probably benign Het
Col24a1 G A 3: 145,524,142 R1483K possibly damaging Het
Crem A T 18: 3,299,226 V82D probably damaging Het
Ctnna2 T A 6: 77,641,440 T180S probably benign Het
Cybrd1 T C 2: 71,129,755 I99T probably benign Het
Cyp4a32 G A 4: 115,621,474 V468M probably damaging Het
Dnah7b A T 1: 46,140,176 Y1003F probably benign Het
Egfem1 A C 3: 29,668,250 E376A possibly damaging Het
Etl4 T A 2: 20,807,354 I1416K probably damaging Het
Fbxl4 A G 4: 22,386,106 T238A probably benign Het
Fer1l6 A G 15: 58,548,338 I33M probably benign Het
Fndc3a A G 14: 72,556,609 S830P probably damaging Het
Fras1 C T 5: 96,755,509 R3082* probably null Het
Galnt13 T C 2: 55,060,492 V395A possibly damaging Het
Gm10334 T G 6: 41,445,256 probably benign Het
Gpd2 C T 2: 57,345,263 T335I probably damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Hydin A G 8: 110,509,127 probably benign Het
Ints5 G T 19: 8,897,133 V819L possibly damaging Het
Klhdc10 C G 6: 30,450,670 Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,479 A67T probably benign Het
Lrp1 T G 10: 127,594,969 T404P probably damaging Het
March7 T C 2: 60,234,126 S249P probably benign Het
Mcm10 T A 2: 5,008,623 K66M probably benign Het
Mtmr7 C A 8: 40,551,601 D645Y probably damaging Het
Muc6 T A 7: 141,636,955 I2602F possibly damaging Het
Myh13 G A 11: 67,369,295 probably benign Het
Myo18a G A 11: 77,850,806 V1776I possibly damaging Het
Ncapg2 T C 12: 116,443,075 L957S probably damaging Het
Ncoa3 T C 2: 166,054,502 S442P probably damaging Het
Olfr1093 G A 2: 86,785,735 E2K probably benign Het
Olfr850 T A 9: 19,477,480 T257S possibly damaging Het
Olfr986 G A 9: 40,187,433 G106D probably damaging Het
Pdcd6 G T 13: 74,309,712 N113K possibly damaging Het
Pfkfb4 C T 9: 109,027,742 probably benign Het
Pfkm A G 15: 98,126,314 H401R probably benign Het
Phldb2 C A 16: 45,781,451 D754Y probably damaging Het
Plekhb2 T A 1: 34,863,114 M49K probably damaging Het
Polrmt A G 10: 79,737,611 S1057P possibly damaging Het
Prps1l1 A G 12: 34,985,078 N64S probably benign Het
Psg16 T C 7: 17,130,658 S393P probably benign Het
Rundc1 C T 11: 101,425,147 T15I probably benign Het
Scaf11 A G 15: 96,431,816 L143S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpinf1 T G 11: 75,413,945 I197L probably benign Het
Siglec1 C T 2: 131,074,525 probably benign Het
Slc28a1 G A 7: 81,138,177 V271I probably benign Het
Sntg1 T C 1: 8,782,824 D34G probably damaging Het
Sptbn4 A T 7: 27,359,736 probably benign Het
Suclg1 T C 6: 73,256,228 I51T possibly damaging Het
Syne1 C T 10: 5,541,989 R9Q probably damaging Het
Trim47 T A 11: 116,106,518 H470L probably damaging Het
Ttc41 T A 10: 86,712,977 Y12N possibly damaging Het
Tubgcp2 T C 7: 140,032,192 E69G probably damaging Het
Tubgcp3 G A 8: 12,641,116 T474M probably damaging Het
Ubr5 A T 15: 38,018,957 N777K probably benign Het
Ush2a T C 1: 188,451,819 L1440P probably damaging Het
Usp28 A C 9: 49,024,067 D458A possibly damaging Het
Vcan A T 13: 89,703,546 D1098E probably damaging Het
Vmn1r73 C T 7: 11,756,846 T197I probably benign Het
Vmn2r15 T C 5: 109,286,478 S787G probably damaging Het
Vmn2r90 T A 17: 17,728,139 I549N probably damaging Het
Vps33b T A 7: 80,283,414 probably null Het
Zfp516 A T 18: 82,987,670 K900* probably null Het
Zfp974 T A 7: 27,910,932 N456I probably damaging Het
Other mutations in Dlk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0041:Dlk1 UTSW 12 109455513 missense probably damaging 1.00
R1250:Dlk1 UTSW 12 109459818 missense probably damaging 1.00
R1363:Dlk1 UTSW 12 109455504 missense probably damaging 1.00
R1757:Dlk1 UTSW 12 109459687 missense probably damaging 1.00
R1763:Dlk1 UTSW 12 109458119 missense probably damaging 1.00
R1772:Dlk1 UTSW 12 109459759 missense probably damaging 1.00
R2189:Dlk1 UTSW 12 109455049 critical splice donor site probably null
R2334:Dlk1 UTSW 12 109453688 missense probably damaging 0.96
R3751:Dlk1 UTSW 12 109460313 missense probably benign 0.15
R5256:Dlk1 UTSW 12 109459771 missense probably damaging 1.00
R5268:Dlk1 UTSW 12 109459838 missense probably benign 0.34
R5356:Dlk1 UTSW 12 109455521 missense probably damaging 0.99
R5669:Dlk1 UTSW 12 109460038 missense probably benign 0.04
R5748:Dlk1 UTSW 12 109459972 missense probably benign 0.00
R5992:Dlk1 UTSW 12 109455581 missense probably damaging 1.00
R6076:Dlk1 UTSW 12 109459969 missense probably damaging 0.98
R6539:Dlk1 UTSW 12 109460319 missense probably benign 0.01
R6638:Dlk1 UTSW 12 109460278 missense probably damaging 1.00
R7480:Dlk1 UTSW 12 109455614 missense probably damaging 1.00
R7553:Dlk1 UTSW 12 109454963 missense unknown
R7602:Dlk1 UTSW 12 109455625 critical splice donor site probably null
R8531:Dlk1 UTSW 12 109458140 missense probably null 0.06
X0020:Dlk1 UTSW 12 109459912 missense probably damaging 1.00
X0053:Dlk1 UTSW 12 109460137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAAAGGTGTCTGCTTTGCACTTG -3'
(R):5'- TACAGTGATCTACAGTGGCCTCCC -3'

Sequencing Primer
(F):5'- AGAAATGCCTACTGTGTGCC -3'
(R):5'- CTGCAAGACACTCTTCTGAtcc -3'
Posted On2013-04-24