Incidental Mutation 'R3899:Crim1'
ID 308907
Institutional Source Beutler Lab
Gene Symbol Crim1
Ensembl Gene ENSMUSG00000024074
Gene Name cysteine rich transmembrane BMP regulator 1 (chordin like)
Synonyms
MMRRC Submission 040809-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3899 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 78200248-78376592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 78281354 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 286 (T286N)
Ref Sequence ENSEMBL: ENSMUSP00000108117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112498]
AlphaFold Q9JLL0
Predicted Effect probably benign
Transcript: ENSMUST00000112498
AA Change: T286N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: T286N

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 35 111 1.87e-5 SMART
VWC 336 390 6.04e-13 SMART
VWC 403 456 1.15e-9 SMART
Pfam:Antistasin 469 498 4.5e-10 PFAM
Pfam:Antistasin 505 532 1.5e-8 PFAM
Pfam:Antistasin 539 564 5.7e-9 PFAM
Pfam:Antistasin 567 592 1.7e-10 PFAM
VWC 608 662 1.26e-10 SMART
VWC 679 734 1.37e-11 SMART
VWC 753 808 1.46e-11 SMART
VWC 819 873 1.01e-14 SMART
transmembrane domain 940 962 N/A INTRINSIC
Meta Mutation Damage Score 0.1120 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,557,237 probably benign Het
Ahctf1 A G 1: 179,777,780 S730P possibly damaging Het
Ankrd26 T A 6: 118,549,428 R327S probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apob A T 12: 8,015,849 I4273F possibly damaging Het
Ascl1 G T 10: 87,492,573 H172Q probably benign Het
Azi2 A G 9: 118,047,503 Y29C probably damaging Het
Baz1a A G 12: 54,934,804 M355T probably benign Het
BC027072 A T 17: 71,750,160 C841S probably benign Het
Brs3 G A X: 57,047,256 V367M possibly damaging Het
Ccdc33 T C 9: 58,032,917 D524G probably damaging Het
Cd300lf T C 11: 115,124,351 T138A probably damaging Het
Ces1g T C 8: 93,303,050 Y518C probably damaging Het
Chek2 C T 5: 110,865,613 probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cntnap2 A T 6: 45,991,903 H193L probably benign Het
Cwc27 T A 13: 104,792,515 K307* probably null Het
Dbx2 T C 15: 95,632,432 D218G possibly damaging Het
Dclk1 G A 3: 55,247,329 R60Q probably damaging Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dpp10 A T 1: 123,353,557 W588R probably damaging Het
Epg5 G A 18: 77,957,510 E554K probably damaging Het
Eya1 T C 1: 14,270,747 T139A probably benign Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Foxd3 A G 4: 99,657,499 Y292C unknown Het
Gli1 C T 10: 127,336,666 M202I possibly damaging Het
Gm973 T C 1: 59,625,140 Y634H probably benign Het
Gpr132 G T 12: 112,852,108 A366E probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 C T 15: 66,030,523 M201I probably benign Het
Khdc3 T C 9: 73,104,346 probably benign Het
Lrrc37a A G 11: 103,497,546 V2351A unknown Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mtr A T 13: 12,216,849 N656K probably benign Het
Mtus1 T C 8: 41,083,129 T517A probably benign Het
Osgep G C 14: 50,924,743 N12K probably damaging Het
Prdx3 T A 19: 60,865,183 T235S probably benign Het
Rasa3 G A 8: 13,578,635 H608Y probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Slc30a5 T C 13: 100,818,147 M170V probably benign Het
Slc4a9 T C 18: 36,535,563 V732A probably benign Het
Slc7a2 C T 8: 40,905,553 T311M possibly damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Stk32b A G 5: 37,457,154 S337P probably damaging Het
Thop1 G A 10: 81,080,444 G429S probably damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Tmem2 A G 19: 21,852,234 T1236A probably benign Het
Tmem45a T C 16: 56,806,738 E256G probably damaging Het
Tox4 T A 14: 52,279,842 Y10N probably damaging Het
Trpm3 A G 19: 22,901,160 M642V possibly damaging Het
Ttll10 T C 4: 156,035,800 T508A probably damaging Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Vmn2r97 T C 17: 18,947,611 I709T probably damaging Het
Zcchc6 T A 13: 59,789,255 K791* probably null Het
Zfp936 T A 7: 43,189,734 N207K possibly damaging Het
Zfp946 T G 17: 22,454,550 I95S probably benign Het
Zhx3 A T 2: 160,780,451 S599T possibly damaging Het
Other mutations in Crim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Crim1 APN 17 78370091 missense probably damaging 1.00
IGL01090:Crim1 APN 17 78347229 missense probably damaging 0.97
IGL01490:Crim1 APN 17 78335296 missense possibly damaging 0.94
IGL01686:Crim1 APN 17 78344434 missense probably benign 0.09
IGL01769:Crim1 APN 17 78313235 missense probably benign 0.02
IGL02004:Crim1 APN 17 78372575 splice site probably benign
IGL02211:Crim1 APN 17 78355145 missense probably damaging 1.00
IGL02275:Crim1 APN 17 78369998 missense possibly damaging 0.56
IGL02408:Crim1 APN 17 78315654 missense possibly damaging 0.78
IGL02411:Crim1 APN 17 78335334 nonsense probably null
IGL02453:Crim1 APN 17 78344484 missense probably damaging 1.00
IGL02481:Crim1 APN 17 78350798 missense probably damaging 0.98
IGL02632:Crim1 APN 17 78372674 missense probably benign 0.08
IGL02652:Crim1 APN 17 78315677 missense probably damaging 1.00
IGL02696:Crim1 APN 17 78279973 missense probably damaging 0.96
IGL02811:Crim1 APN 17 78350701 missense possibly damaging 0.62
IGL03105:Crim1 APN 17 78315750 splice site probably benign
IGL03349:Crim1 APN 17 78355150 nonsense probably null
bugeye UTSW 17 78281347 missense possibly damaging 0.94
IGL03097:Crim1 UTSW 17 78367798 missense probably benign 0.00
R0227:Crim1 UTSW 17 78344509 splice site probably benign
R0458:Crim1 UTSW 17 78313226 missense probably damaging 0.98
R0482:Crim1 UTSW 17 78372579 missense probably benign 0.00
R0989:Crim1 UTSW 17 78200944 missense probably benign 0.21
R1266:Crim1 UTSW 17 78200833 small deletion probably benign
R1529:Crim1 UTSW 17 78367954 missense probably benign
R1679:Crim1 UTSW 17 78200799 missense probably benign 0.27
R1909:Crim1 UTSW 17 78313127 missense probably benign 0.26
R2273:Crim1 UTSW 17 78355179 critical splice donor site probably null
R3909:Crim1 UTSW 17 78281239 splice site probably benign
R4092:Crim1 UTSW 17 78350836 missense probably damaging 1.00
R4154:Crim1 UTSW 17 78237843 missense probably benign 0.01
R4687:Crim1 UTSW 17 78303025 missense probably damaging 1.00
R5022:Crim1 UTSW 17 78280129 missense possibly damaging 0.95
R5073:Crim1 UTSW 17 78281347 missense possibly damaging 0.94
R5089:Crim1 UTSW 17 78374090 missense probably damaging 1.00
R5284:Crim1 UTSW 17 78313266 missense possibly damaging 0.83
R5461:Crim1 UTSW 17 78237807 missense probably damaging 1.00
R5635:Crim1 UTSW 17 78315641 missense probably damaging 1.00
R5686:Crim1 UTSW 17 78374083 missense possibly damaging 0.63
R5956:Crim1 UTSW 17 78315717 missense probably damaging 1.00
R6117:Crim1 UTSW 17 78303088 missense probably damaging 1.00
R6129:Crim1 UTSW 17 78281309 missense probably benign 0.17
R6265:Crim1 UTSW 17 78370085 missense probably benign 0.01
R6812:Crim1 UTSW 17 78315600 missense probably damaging 1.00
R6858:Crim1 UTSW 17 78315627 missense probably damaging 1.00
R7920:Crim1 UTSW 17 78303064 missense probably damaging 1.00
R8022:Crim1 UTSW 17 78315555 missense possibly damaging 0.82
R8434:Crim1 UTSW 17 78347257 missense probably benign 0.00
R8782:Crim1 UTSW 17 78200877 missense probably damaging 1.00
R8961:Crim1 UTSW 17 78372688 missense possibly damaging 0.65
R8971:Crim1 UTSW 17 78345980 missense possibly damaging 0.89
R9245:Crim1 UTSW 17 78344442 missense probably damaging 1.00
R9250:Crim1 UTSW 17 78370042 missense probably benign
R9401:Crim1 UTSW 17 78350865 frame shift probably null
R9402:Crim1 UTSW 17 78350865 frame shift probably null
R9644:Crim1 UTSW 17 78280068 missense probably damaging 1.00
R9702:Crim1 UTSW 17 78374087 missense probably damaging 1.00
R9710:Crim1 UTSW 17 78303075 nonsense probably null
X0064:Crim1 UTSW 17 78200833 small deletion probably benign
Z1088:Crim1 UTSW 17 78367835 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GCTGCACACTTGTCAAGAGTC -3'
(R):5'- CATGACACTTGGCTTTGATGTGAG -3'

Sequencing Primer
(F):5'- GCACACTTGTCAAGAGTCGTTATATC -3'
(R):5'- GCTTTGATGTGAGGAGAGACATATG -3'
Posted On 2015-04-17