Mutagenetix > Incidental Mutation

Incidental Mutation 'R3899:Crim1'

308907

Institutional Source

Beutler Lab

Gene Symbol

Crim1

Ensembl Gene

ENSMUSG00000024074

Gene Name

cysteine rich transmembrane BMP regulator 1 (chordin like)

Synonyms

MMRRC Submission

040809-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3899 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78200248-78376592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 78281354 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 286 (T286N)

Ref Sequence

ENSEMBL: ENSMUSP00000108117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112498]

AlphaFold

Q9JLL0

Predicted Effect

probably benign
Transcript: ENSMUST00000112498
AA Change: T286N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: T286N

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
IB	35	111	1.87e-5	SMART
VWC	336	390	6.04e-13	SMART
VWC	403	456	1.15e-9	SMART
Pfam:Antistasin	469	498	4.5e-10	PFAM
Pfam:Antistasin	505	532	1.5e-8	PFAM
Pfam:Antistasin	539	564	5.7e-9	PFAM
Pfam:Antistasin	567	592	1.7e-10	PFAM
VWC	608	662	1.26e-10	SMART
VWC	679	734	1.37e-11	SMART
VWC	753	808	1.46e-11	SMART
VWC	819	873	1.01e-14	SMART
transmembrane domain	940	962	N/A	INTRINSIC

Meta Mutation Damage Score

0.1120

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	A	G	2: 155,557,237		probably benign	Het
Ahctf1	A	G	1: 179,777,780	S730P	possibly damaging	Het
Ankrd26	T	A	6: 118,549,428	R327S	probably benign	Het
Anpep	A	G	7: 79,839,225	S372P	probably benign	Het
Apob	A	T	12: 8,015,849	I4273F	possibly damaging	Het
Ascl1	G	T	10: 87,492,573	H172Q	probably benign	Het
Azi2	A	G	9: 118,047,503	Y29C	probably damaging	Het
Baz1a	A	G	12: 54,934,804	M355T	probably benign	Het
BC027072	A	T	17: 71,750,160	C841S	probably benign	Het
Brs3	G	A	X: 57,047,256	V367M	possibly damaging	Het
Ccdc33	T	C	9: 58,032,917	D524G	probably damaging	Het
Cd300lf	T	C	11: 115,124,351	T138A	probably damaging	Het
Ces1g	T	C	8: 93,303,050	Y518C	probably damaging	Het
Chek2	C	T	5: 110,865,613		probably benign	Het
Cherp	A	G	8: 72,469,936	I201T	possibly damaging	Het
Cntnap2	A	T	6: 45,991,903	H193L	probably benign	Het
Cwc27	T	A	13: 104,792,515	K307*	probably null	Het
Dbx2	T	C	15: 95,632,432	D218G	possibly damaging	Het
Dclk1	G	A	3: 55,247,329	R60Q	probably damaging	Het
Dnah17	A	T	11: 118,094,808	I1481N	possibly damaging	Het
Dnah8	G	A	17: 30,854,898	R4514H	probably damaging	Het
Dpp10	A	T	1: 123,353,557	W588R	probably damaging	Het
Epg5	G	A	18: 77,957,510	E554K	probably damaging	Het
Eya1	T	C	1: 14,270,747	T139A	probably benign	Het
Fchsd2	A	G	7: 101,191,799	K172E	possibly damaging	Het
Foxd3	A	G	4: 99,657,499	Y292C	unknown	Het
Gli1	C	T	10: 127,336,666	M202I	possibly damaging	Het
Gm973	T	C	1: 59,625,140	Y634H	probably benign	Het
Gpr132	G	T	12: 112,852,108	A366E	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kcnq3	C	T	15: 66,030,523	M201I	probably benign	Het
Khdc3	T	C	9: 73,104,346		probably benign	Het
Lrrc37a	A	G	11: 103,497,546	V2351A	unknown	Het
Mmrn2	G	T	14: 34,399,560		probably null	Het
Mtr	A	T	13: 12,216,849	N656K	probably benign	Het
Mtus1	T	C	8: 41,083,129	T517A	probably benign	Het
Osgep	G	C	14: 50,924,743	N12K	probably damaging	Het
Prdx3	T	A	19: 60,865,183	T235S	probably benign	Het
Rasa3	G	A	8: 13,578,635	H608Y	probably benign	Het
Rd3	T	C	1: 191,985,256	V114A	probably damaging	Het
Setd2	C	T	9: 110,592,518	R273W	probably damaging	Het
Slc24a1	A	T	9: 64,928,144	S900R	probably damaging	Het
Slc30a5	T	C	13: 100,818,147	M170V	probably benign	Het
Slc4a9	T	C	18: 36,535,563	V732A	probably benign	Het
Slc7a2	C	T	8: 40,905,553	T311M	possibly damaging	Het
Smarcc1	T	C	9: 110,118,518		probably benign	Het
Stk32b	A	G	5: 37,457,154	S337P	probably damaging	Het
Thop1	G	A	10: 81,080,444	G429S	probably damaging	Het
Timp2	C	T	11: 118,303,716	D139N	probably damaging	Het
Tmem2	A	G	19: 21,852,234	T1236A	probably benign	Het
Tmem45a	T	C	16: 56,806,738	E256G	probably damaging	Het
Tox4	T	A	14: 52,279,842	Y10N	probably damaging	Het
Trpm3	A	G	19: 22,901,160	M642V	possibly damaging	Het
Ttll10	T	C	4: 156,035,800	T508A	probably damaging	Het
Ubash3b	C	T	9: 41,031,564	D211N	probably benign	Het
Usp36	T	A	11: 118,279,824	D28V	possibly damaging	Het
Vmn2r97	T	C	17: 18,947,611	I709T	probably damaging	Het
Zcchc6	T	A	13: 59,789,255	K791*	probably null	Het
Zfp936	T	A	7: 43,189,734	N207K	possibly damaging	Het
Zfp946	T	G	17: 22,454,550	I95S	probably benign	Het
Zhx3	A	T	2: 160,780,451	S599T	possibly damaging	Het

Other mutations in Crim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Crim1	APN	17	78370091	missense	probably damaging	1.00
IGL01090:Crim1	APN	17	78347229	missense	probably damaging	0.97
IGL01490:Crim1	APN	17	78335296	missense	possibly damaging	0.94
IGL01686:Crim1	APN	17	78344434	missense	probably benign	0.09
IGL01769:Crim1	APN	17	78313235	missense	probably benign	0.02
IGL02004:Crim1	APN	17	78372575	splice site	probably benign
IGL02211:Crim1	APN	17	78355145	missense	probably damaging	1.00
IGL02275:Crim1	APN	17	78369998	missense	possibly damaging	0.56
IGL02408:Crim1	APN	17	78315654	missense	possibly damaging	0.78
IGL02411:Crim1	APN	17	78335334	nonsense	probably null
IGL02453:Crim1	APN	17	78344484	missense	probably damaging	1.00
IGL02481:Crim1	APN	17	78350798	missense	probably damaging	0.98
IGL02632:Crim1	APN	17	78372674	missense	probably benign	0.08
IGL02652:Crim1	APN	17	78315677	missense	probably damaging	1.00
IGL02696:Crim1	APN	17	78279973	missense	probably damaging	0.96
IGL02811:Crim1	APN	17	78350701	missense	possibly damaging	0.62
IGL03105:Crim1	APN	17	78315750	splice site	probably benign
IGL03349:Crim1	APN	17	78355150	nonsense	probably null
bugeye	UTSW	17	78281347	missense	possibly damaging	0.94
IGL03097:Crim1	UTSW	17	78367798	missense	probably benign	0.00
R0227:Crim1	UTSW	17	78344509	splice site	probably benign
R0458:Crim1	UTSW	17	78313226	missense	probably damaging	0.98
R0482:Crim1	UTSW	17	78372579	missense	probably benign	0.00
R0989:Crim1	UTSW	17	78200944	missense	probably benign	0.21
R1266:Crim1	UTSW	17	78200833	small deletion	probably benign
R1529:Crim1	UTSW	17	78367954	missense	probably benign
R1679:Crim1	UTSW	17	78200799	missense	probably benign	0.27
R1909:Crim1	UTSW	17	78313127	missense	probably benign	0.26
R2273:Crim1	UTSW	17	78355179	critical splice donor site	probably null
R3909:Crim1	UTSW	17	78281239	splice site	probably benign
R4092:Crim1	UTSW	17	78350836	missense	probably damaging	1.00
R4154:Crim1	UTSW	17	78237843	missense	probably benign	0.01
R4687:Crim1	UTSW	17	78303025	missense	probably damaging	1.00
R5022:Crim1	UTSW	17	78280129	missense	possibly damaging	0.95
R5073:Crim1	UTSW	17	78281347	missense	possibly damaging	0.94
R5089:Crim1	UTSW	17	78374090	missense	probably damaging	1.00
R5284:Crim1	UTSW	17	78313266	missense	possibly damaging	0.83
R5461:Crim1	UTSW	17	78237807	missense	probably damaging	1.00
R5635:Crim1	UTSW	17	78315641	missense	probably damaging	1.00
R5686:Crim1	UTSW	17	78374083	missense	possibly damaging	0.63
R5956:Crim1	UTSW	17	78315717	missense	probably damaging	1.00
R6117:Crim1	UTSW	17	78303088	missense	probably damaging	1.00
R6129:Crim1	UTSW	17	78281309	missense	probably benign	0.17
R6265:Crim1	UTSW	17	78370085	missense	probably benign	0.01
R6812:Crim1	UTSW	17	78315600	missense	probably damaging	1.00
R6858:Crim1	UTSW	17	78315627	missense	probably damaging	1.00
R7920:Crim1	UTSW	17	78303064	missense	probably damaging	1.00
R8022:Crim1	UTSW	17	78315555	missense	possibly damaging	0.82
R8434:Crim1	UTSW	17	78347257	missense	probably benign	0.00
R8782:Crim1	UTSW	17	78200877	missense	probably damaging	1.00
R8961:Crim1	UTSW	17	78372688	missense	possibly damaging	0.65
R8971:Crim1	UTSW	17	78345980	missense	possibly damaging	0.89
R9245:Crim1	UTSW	17	78344442	missense	probably damaging	1.00
R9250:Crim1	UTSW	17	78370042	missense	probably benign
R9401:Crim1	UTSW	17	78350865	frame shift	probably null
R9402:Crim1	UTSW	17	78350865	frame shift	probably null
R9644:Crim1	UTSW	17	78280068	missense	probably damaging	1.00
R9702:Crim1	UTSW	17	78374087	missense	probably damaging	1.00
R9710:Crim1	UTSW	17	78303075	nonsense	probably null
X0064:Crim1	UTSW	17	78200833	small deletion	probably benign
Z1088:Crim1	UTSW	17	78367835	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- GCTGCACACTTGTCAAGAGTC -3'
(R):5'- CATGACACTTGGCTTTGATGTGAG -3'

Sequencing Primer
(F):5'- GCACACTTGTCAAGAGTCGTTATATC -3'
(R):5'- GCTTTGATGTGAGGAGAGACATATG -3'

Posted On

2015-04-17