Incidental Mutation 'R3900:Olfr1201'
ID308919
Institutional Source Beutler Lab
Gene Symbol Olfr1201
Ensembl Gene ENSMUSG00000059023
Gene Nameolfactory receptor 1201
SynonymsGA_x6K02T2Q125-50268830-50269753, MOR230-2
MMRRC Submission 041607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3900 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88793036-88796827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88794929 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 182 (L182F)
Ref Sequence ENSEMBL: ENSMUSP00000150454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073458] [ENSMUST00000216213]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073458
AA Change: L182F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073163
Gene: ENSMUSG00000059023
AA Change: L182F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.4e-46 PFAM
Pfam:7TM_GPCR_Srsx 32 300 3.3e-5 PFAM
Pfam:7tm_1 39 285 3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214018
Predicted Effect possibly damaging
Transcript: ENSMUST00000216213
AA Change: L182F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A T 13: 54,552,968 S212R probably damaging Het
AI182371 T C 2: 35,085,216 I334V probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apc2 C A 10: 80,295,972 probably null Het
Bcl6 T G 16: 23,977,554 E41A possibly damaging Het
Brpf1 A G 6: 113,318,433 I674V probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cluh A G 11: 74,667,104 H1056R probably benign Het
Csgalnact2 A T 6: 118,121,014 F122I probably damaging Het
Cubn C A 2: 13,286,980 probably null Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Eif2ak4 A G 2: 118,475,029 Y1561C probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Eml5 G A 12: 98,825,523 R1245C probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm6133 A G 18: 78,350,150 N120D probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T C 1: 172,489,558 L35P probably damaging Het
Khdc3 T C 9: 73,104,346 probably benign Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mrgpra1 G T 7: 47,335,527 R135S possibly damaging Het
Olfr971 A G 9: 39,839,402 probably null Het
Otud3 T C 4: 138,896,885 N282S probably benign Het
Prkar1a A G 11: 109,661,075 K130R probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Rictor T G 15: 6,789,473 D1392E probably benign Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc22a18 C A 7: 143,479,770 A86E probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Smoc1 T C 12: 81,167,513 V234A probably damaging Het
Stard9 A G 2: 120,713,549 T4443A possibly damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Trim69 A G 2: 122,178,841 T461A probably benign Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Ubr4 T C 4: 139,479,062 probably null Het
Ubr5 T C 15: 38,019,242 D752G probably damaging Het
Urb1 A T 16: 90,783,376 I633N possibly damaging Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Wdr6 G A 9: 108,575,769 A305V probably damaging Het
Zfp248 T C 6: 118,429,566 N253S probably damaging Het
Other mutations in Olfr1201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Olfr1201 APN 2 88795293 missense probably benign
IGL02292:Olfr1201 APN 2 88795287 missense probably benign
IGL03037:Olfr1201 APN 2 88794955 missense probably damaging 1.00
R2341:Olfr1201 UTSW 2 88794645 missense probably benign 0.16
R6394:Olfr1201 UTSW 2 88794952 missense probably benign 0.22
R7276:Olfr1201 UTSW 2 88794681 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCTTGCGTTACTCAGTC -3'
(R):5'- AAAGTAGTTGGTGGCCGTGC -3'

Sequencing Primer
(F):5'- CGTTACTCAGTCATCATGAGGCG -3'
(R):5'- GTGGCCGTGCATATATGAATATG -3'
Posted On2015-04-17