Mutagenetix > Incidental Mutations

Incidental Mutation 'R3900:Trim69'

308922

Institutional Source

Beutler Lab

Gene Symbol

Trim69

Ensembl Gene

ENSMUSG00000033368

Gene Name

tripartite motif-containing 69

Synonyms

4921519C19Rik, Rnf36, Trif

MMRRC Submission

041607-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R3900 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122160700-122179027 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122178841 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 461 (T461A)

Ref Sequence

ENSEMBL: ENSMUSP00000047627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028665] [ENSMUST00000036089]

Predicted Effect

probably benign
Transcript: ENSMUST00000028665

SMART Domains

Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233

Domain	Start	End	E-Value	Type
low complexity region	33	41	N/A	INTRINSIC
low complexity region	143	165	N/A	INTRINSIC
low complexity region	215	227	N/A	INTRINSIC
Pfam:PAT1	247	490	6.7e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000036089
AA Change: T461A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000047627
Gene: ENSMUSG00000033368
AA Change: T461A

Domain	Start	End	E-Value	Type
RING	42	82	8.48e-8	SMART
low complexity region	95	111	N/A	INTRINSIC
PDB:4NQJ\|C	144	322	2e-86	PDB
PRY	323	375	9.37e-19	SMART
SPRY	376	500	4.97e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143088

Meta Mutation Damage Score

0.2864

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833439L19Rik	A	T	13: 54,552,968	S212R	probably damaging	Het
AI182371	T	C	2: 35,085,216	I334V	probably benign	Het
Anpep	A	G	7: 79,839,225	S372P	probably benign	Het
Apc2	C	A	10: 80,295,972		probably null	Het
Bcl6	T	G	16: 23,977,554	E41A	possibly damaging	Het
Brpf1	A	G	6: 113,318,433	I674V	probably benign	Het
Cherp	A	G	8: 72,469,936	I201T	possibly damaging	Het
Cluh	A	G	11: 74,667,104	H1056R	probably benign	Het
Csgalnact2	A	T	6: 118,121,014	F122I	probably damaging	Het
Cubn	C	A	2: 13,286,980		probably null	Het
Dnah17	A	T	11: 118,094,808	I1481N	possibly damaging	Het
Eif2ak4	A	G	2: 118,475,029	Y1561C	probably damaging	Het
Elfn1	G	A	5: 139,971,964	R241H	probably damaging	Het
Eml5	G	A	12: 98,825,523	R1245C	probably damaging	Het
Fchsd2	A	G	7: 101,191,799	K172E	possibly damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm6133	A	G	18: 78,350,150	N120D	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Igsf9	T	C	1: 172,489,558	L35P	probably damaging	Het
Khdc3	T	C	9: 73,104,346		probably benign	Het
Mmrn2	G	T	14: 34,399,560		probably null	Het
Mrgpra1	G	T	7: 47,335,527	R135S	possibly damaging	Het
Olfr1201	A	T	2: 88,794,929	L182F	possibly damaging	Het
Olfr971	A	G	9: 39,839,402		probably null	Het
Otud3	T	C	4: 138,896,885	N282S	probably benign	Het
Prkar1a	A	G	11: 109,661,075	K130R	probably benign	Het
Rd3	T	C	1: 191,985,256	V114A	probably damaging	Het
Rictor	T	G	15: 6,789,473	D1392E	probably benign	Het
Setd2	C	T	9: 110,592,518	R273W	probably damaging	Het
Slc22a18	C	A	7: 143,479,770	A86E	probably damaging	Het
Slc24a1	A	T	9: 64,928,144	S900R	probably damaging	Het
Smarcc1	T	C	9: 110,118,518		probably benign	Het
Smoc1	T	C	12: 81,167,513	V234A	probably damaging	Het
Stard9	A	G	2: 120,713,549	T4443A	possibly damaging	Het
Timp2	C	T	11: 118,303,716	D139N	probably damaging	Het
Ubash3b	C	T	9: 41,031,564	D211N	probably benign	Het
Ubr4	T	C	4: 139,479,062		probably null	Het
Ubr5	T	C	15: 38,019,242	D752G	probably damaging	Het
Urb1	A	T	16: 90,783,376	I633N	possibly damaging	Het
Usp36	T	A	11: 118,279,824	D28V	possibly damaging	Het
Wdr6	G	A	9: 108,575,769	A305V	probably damaging	Het
Zfp248	T	C	6: 118,429,566	N253S	probably damaging	Het

Other mutations in Trim69

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00663:Trim69	APN	2	122167714	missense	probably benign	0.00
IGL01321:Trim69	APN	2	122173284	missense	possibly damaging	0.84
IGL01478:Trim69	APN	2	122178443	missense	probably damaging	0.98
IGL01907:Trim69	APN	2	122167661	missense	probably benign	0.00
IGL01925:Trim69	APN	2	122167916	missense	probably damaging	1.00
IGL03065:Trim69	APN	2	122178634	missense	probably damaging	0.98
IGL03121:Trim69	APN	2	122167647	missense	probably benign	0.22
IGL03206:Trim69	APN	2	122173155	missense	probably benign	0.00
R0019:Trim69	UTSW	2	122174477	splice site	probably null
R0019:Trim69	UTSW	2	122174477	splice site	probably null
R1956:Trim69	UTSW	2	122174475	critical splice donor site	probably null
R1960:Trim69	UTSW	2	122167684	missense	probably benign	0.00
R2212:Trim69	UTSW	2	122178644	missense	probably benign	0.05
R3412:Trim69	UTSW	2	122178644	missense	probably benign	0.05
R3414:Trim69	UTSW	2	122178644	missense	probably benign	0.05
R4470:Trim69	UTSW	2	122178599	missense	probably damaging	1.00
R4950:Trim69	UTSW	2	122178746	missense	probably damaging	1.00
R5045:Trim69	UTSW	2	122174246	missense	probably benign	0.08
R5237:Trim69	UTSW	2	122173340	missense	probably benign
R5931:Trim69	UTSW	2	122178594	missense	probably damaging	0.98
R6483:Trim69	UTSW	2	122167600	nonsense	probably null
R6872:Trim69	UTSW	2	122167910	missense	probably damaging	1.00
R7372:Trim69	UTSW	2	122178583	missense	possibly damaging	0.94
R7451:Trim69	UTSW	2	122168027	missense	probably benign	0.19
R7591:Trim69	UTSW	2	122167973	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- ATCATTCGGAAGGGGAGCTG -3'
(R):5'- TGGTGAATCCTGCTTTCATTAGTTC -3'

Sequencing Primer
(F):5'- AGCTGCCCTCTGACTCCAG -3'
(R):5'- AGTTCAGAGATCCCCATAAATTGG -3'

Posted On

2015-04-17