Incidental Mutation 'R3900:Elfn1'
ID308927
Institutional Source Beutler Lab
Gene Symbol Elfn1
Ensembl Gene ENSMUSG00000048988
Gene Nameleucine rich repeat and fibronectin type III, extracellular 1
Synonyms
MMRRC Submission 041607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R3900 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location139907943-139974722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139971964 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 241 (R241H)
Ref Sequence ENSEMBL: ENSMUSP00000053869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050519]
Predicted Effect probably damaging
Transcript: ENSMUST00000050519
AA Change: R241H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053869
Gene: ENSMUSG00000048988
AA Change: R241H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 83 106 3.24e0 SMART
LRR 109 130 9.22e0 SMART
LRR 131 154 4.2e0 SMART
LRR 155 178 6.78e1 SMART
LRRCT 190 240 4.49e-4 SMART
low complexity region 268 288 N/A INTRINSIC
low complexity region 300 313 N/A INTRINSIC
Blast:FN3 314 389 1e-27 BLAST
low complexity region 400 413 N/A INTRINSIC
transmembrane domain 418 440 N/A INTRINSIC
low complexity region 441 463 N/A INTRINSIC
low complexity region 632 652 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198608
Meta Mutation Damage Score 0.1157 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
MGI Phenotype PHENOTYPE: Homozygous mutants display impaired coordination, hyperactivity, lower anxiety-related response, and increased susceptibility to induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A T 13: 54,552,968 S212R probably damaging Het
AI182371 T C 2: 35,085,216 I334V probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apc2 C A 10: 80,295,972 probably null Het
Bcl6 T G 16: 23,977,554 E41A possibly damaging Het
Brpf1 A G 6: 113,318,433 I674V probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cluh A G 11: 74,667,104 H1056R probably benign Het
Csgalnact2 A T 6: 118,121,014 F122I probably damaging Het
Cubn C A 2: 13,286,980 probably null Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Eif2ak4 A G 2: 118,475,029 Y1561C probably damaging Het
Eml5 G A 12: 98,825,523 R1245C probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm6133 A G 18: 78,350,150 N120D probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T C 1: 172,489,558 L35P probably damaging Het
Khdc3 T C 9: 73,104,346 probably benign Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mrgpra1 G T 7: 47,335,527 R135S possibly damaging Het
Olfr1201 A T 2: 88,794,929 L182F possibly damaging Het
Olfr971 A G 9: 39,839,402 probably null Het
Otud3 T C 4: 138,896,885 N282S probably benign Het
Prkar1a A G 11: 109,661,075 K130R probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Rictor T G 15: 6,789,473 D1392E probably benign Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc22a18 C A 7: 143,479,770 A86E probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Smoc1 T C 12: 81,167,513 V234A probably damaging Het
Stard9 A G 2: 120,713,549 T4443A possibly damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Trim69 A G 2: 122,178,841 T461A probably benign Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Ubr4 T C 4: 139,479,062 probably null Het
Ubr5 T C 15: 38,019,242 D752G probably damaging Het
Urb1 A T 16: 90,783,376 I633N possibly damaging Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Wdr6 G A 9: 108,575,769 A305V probably damaging Het
Zfp248 T C 6: 118,429,566 N253S probably damaging Het
Other mutations in Elfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1969:Elfn1 UTSW 5 139972849 missense probably damaging 1.00
R2010:Elfn1 UTSW 5 139973316 missense probably damaging 1.00
R3702:Elfn1 UTSW 5 139972359 missense probably benign
R3898:Elfn1 UTSW 5 139971964 missense probably damaging 1.00
R4284:Elfn1 UTSW 5 139972314 nonsense probably null
R4416:Elfn1 UTSW 5 139972194 missense possibly damaging 0.52
R4575:Elfn1 UTSW 5 139972053 missense probably benign
R4576:Elfn1 UTSW 5 139972053 missense probably benign
R4578:Elfn1 UTSW 5 139972053 missense probably benign
R4617:Elfn1 UTSW 5 139972009 missense probably damaging 0.99
R4729:Elfn1 UTSW 5 139973658 missense probably damaging 1.00
R4857:Elfn1 UTSW 5 139973085 missense probably damaging 1.00
R5431:Elfn1 UTSW 5 139971568 missense probably damaging 0.99
R5456:Elfn1 UTSW 5 139972816 missense probably damaging 1.00
R6463:Elfn1 UTSW 5 139972285 missense probably damaging 1.00
R6841:Elfn1 UTSW 5 139973145 missense probably damaging 1.00
R6925:Elfn1 UTSW 5 139971685 missense probably benign 0.02
R7224:Elfn1 UTSW 5 139972473 missense probably benign 0.00
R7465:Elfn1 UTSW 5 139972087 missense probably benign 0.34
V7732:Elfn1 UTSW 5 139971439 missense probably damaging 1.00
Z1177:Elfn1 UTSW 5 139972308 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTCCATGAATCGCATCCAGC -3'
(R):5'- GGAGAAGCACTCGTCATCAG -3'

Sequencing Primer
(F):5'- TGAATCGCATCCAGCAGCTG -3'
(R):5'- ACTCGTCATCAGCGCAG -3'
Posted On2015-04-17