Incidental Mutation 'R3900:Csgalnact2'
ID308929
Institutional Source Beutler Lab
Gene Symbol Csgalnact2
Ensembl Gene ENSMUSG00000042042
Gene Namechondroitin sulfate N-acetylgalactosaminyltransferase 2
Synonyms4632415D10Rik, Galnact2
MMRRC Submission 041607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R3900 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location118107452-118139140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118121014 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 122 (F122I)
Ref Sequence ENSEMBL: ENSMUSP00000116371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049344] [ENSMUST00000136265]
Predicted Effect probably damaging
Transcript: ENSMUST00000049344
AA Change: F364I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039819
Gene: ENSMUSG00000042042
AA Change: F364I

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:CHGN 53 516 3e-83 PFAM
Pfam:Glyco_tranf_2_2 273 477 4.1e-8 PFAM
Pfam:Glyco_transf_7C 413 489 1.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125531
Predicted Effect probably damaging
Transcript: ENSMUST00000136265
AA Change: F122I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116371
Gene: ENSMUSG00000042042
AA Change: F122I

DomainStartEndE-ValueType
Pfam:CHGN 2 223 5.8e-45 PFAM
Pfam:Glyco_tranf_2_2 31 223 6.5e-9 PFAM
Pfam:Glyco_transf_7C 170 223 1.2e-9 PFAM
Meta Mutation Damage Score 0.9165 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chondroitin N-acetylgalactosaminyltransferase family. The encoded protein is involved in elongation during chondroitin sulfate synthesis. Alternative splicing of this gene results in multiple transcript variants. Two related pseudogenes have been identified on chromosome X. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A T 13: 54,552,968 S212R probably damaging Het
AI182371 T C 2: 35,085,216 I334V probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apc2 C A 10: 80,295,972 probably null Het
Bcl6 T G 16: 23,977,554 E41A possibly damaging Het
Brpf1 A G 6: 113,318,433 I674V probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cluh A G 11: 74,667,104 H1056R probably benign Het
Cubn C A 2: 13,286,980 probably null Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Eif2ak4 A G 2: 118,475,029 Y1561C probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Eml5 G A 12: 98,825,523 R1245C probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm6133 A G 18: 78,350,150 N120D probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T C 1: 172,489,558 L35P probably damaging Het
Khdc3 T C 9: 73,104,346 probably benign Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mrgpra1 G T 7: 47,335,527 R135S possibly damaging Het
Olfr1201 A T 2: 88,794,929 L182F possibly damaging Het
Olfr971 A G 9: 39,839,402 probably null Het
Otud3 T C 4: 138,896,885 N282S probably benign Het
Prkar1a A G 11: 109,661,075 K130R probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Rictor T G 15: 6,789,473 D1392E probably benign Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc22a18 C A 7: 143,479,770 A86E probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Smoc1 T C 12: 81,167,513 V234A probably damaging Het
Stard9 A G 2: 120,713,549 T4443A possibly damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Trim69 A G 2: 122,178,841 T461A probably benign Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Ubr4 T C 4: 139,479,062 probably null Het
Ubr5 T C 15: 38,019,242 D752G probably damaging Het
Urb1 A T 16: 90,783,376 I633N possibly damaging Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Wdr6 G A 9: 108,575,769 A305V probably damaging Het
Zfp248 T C 6: 118,429,566 N253S probably damaging Het
Other mutations in Csgalnact2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Csgalnact2 APN 6 118126272 start codon destroyed probably null 0.88
IGL00955:Csgalnact2 APN 6 118129264 missense probably damaging 1.00
IGL01396:Csgalnact2 APN 6 118126327 missense probably damaging 1.00
IGL01757:Csgalnact2 APN 6 118129346 missense probably damaging 1.00
IGL02687:Csgalnact2 APN 6 118124415 critical splice acceptor site probably null
IGL02833:Csgalnact2 APN 6 118129268 missense probably damaging 1.00
IGL02837:Csgalnact2 UTSW 6 118124403 missense probably benign 0.10
R0206:Csgalnact2 UTSW 6 118114386 missense probably benign 0.13
R0761:Csgalnact2 UTSW 6 118126112 splice site probably benign
R1201:Csgalnact2 UTSW 6 118114432 missense probably damaging 0.98
R2106:Csgalnact2 UTSW 6 118109129 nonsense probably null
R3773:Csgalnact2 UTSW 6 118126219 missense probably benign 0.17
R5618:Csgalnact2 UTSW 6 118126316 missense probably damaging 0.99
R5682:Csgalnact2 UTSW 6 118120992 missense probably damaging 1.00
R5744:Csgalnact2 UTSW 6 118126236 missense probably damaging 1.00
R5895:Csgalnact2 UTSW 6 118129254 nonsense probably null
R7819:Csgalnact2 UTSW 6 118121089 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AGGGTCAGAGTTTCAACTTACTACTC -3'
(R):5'- CTGCTGTTGAAGAAAAGACATTGTC -3'

Sequencing Primer
(F):5'- CCATCCCAAGGTTGAATGAAGACG -3'
(R):5'- GACATTGTCAACCTCTAAATGGGAC -3'
Posted On2015-04-17