Incidental Mutation 'R0379:Pdcd6'
ID30893
Institutional Source Beutler Lab
Gene Symbol Pdcd6
Ensembl Gene ENSMUSG00000021576
Gene Nameprogrammed cell death 6
SynonymsPS2, Alg2, alg-2, MA-3
MMRRC Submission 038585-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0379 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location74303509-74317580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 74309712 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 113 (N113K)
Ref Sequence ENSEMBL: ENSMUSP00000152458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022060] [ENSMUST00000222759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022060
AA Change: N113K

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022060
Gene: ENSMUSG00000021576
AA Change: N113K

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
EFh 27 55 1.76e0 SMART
EFh 64 92 2.98e1 SMART
EFh 94 122 1.4e-5 SMART
EFh 130 158 8.33e1 SMART
EFh 160 190 6.2e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220861
Predicted Effect possibly damaging
Transcript: ENSMUST00000222759
AA Change: N113K

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222993
Meta Mutation Damage Score 0.0847 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding protein belonging to the penta-EF-hand protein family. Calcium binding is important for homodimerization and for conformational changes required for binding to other protein partners. This gene product participates in T cell receptor-, Fas-, and glucocorticoid-induced programmed cell death. In mice deficient for this gene product, however, apoptosis was not blocked suggesting this gene product is functionally redundant. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is also located on the short arm of chromosome 5. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and do not exhibit any developmental defects or immune dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,785,546 probably benign Het
4930512M02Rik A G 11: 11,589,365 probably benign Het
Apba1 A C 19: 23,934,830 N558T probably damaging Het
Arfgef2 T A 2: 166,860,400 probably null Het
Arsb T C 13: 93,940,627 S501P probably benign Het
Atp10b A G 11: 43,254,314 T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 R648L probably damaging Het
Bcl2a1b T C 9: 89,199,736 I126T possibly damaging Het
Brd9 T C 13: 73,942,683 probably benign Het
Cd93 T C 2: 148,441,510 probably benign Het
Chd5 A G 4: 152,383,321 K1692R probably benign Het
Clcn4 T C 7: 7,296,792 T13A probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Clec4g A G 8: 3,718,440 V97A probably benign Het
Col24a1 G A 3: 145,524,142 R1483K possibly damaging Het
Crem A T 18: 3,299,226 V82D probably damaging Het
Ctnna2 T A 6: 77,641,440 T180S probably benign Het
Cybrd1 T C 2: 71,129,755 I99T probably benign Het
Cyp4a32 G A 4: 115,621,474 V468M probably damaging Het
Dlk1 A G 12: 109,455,059 probably benign Het
Dnah7b A T 1: 46,140,176 Y1003F probably benign Het
Egfem1 A C 3: 29,668,250 E376A possibly damaging Het
Etl4 T A 2: 20,807,354 I1416K probably damaging Het
Fbxl4 A G 4: 22,386,106 T238A probably benign Het
Fer1l6 A G 15: 58,548,338 I33M probably benign Het
Fndc3a A G 14: 72,556,609 S830P probably damaging Het
Fras1 C T 5: 96,755,509 R3082* probably null Het
Galnt13 T C 2: 55,060,492 V395A possibly damaging Het
Gm10334 T G 6: 41,445,256 probably benign Het
Gpd2 C T 2: 57,345,263 T335I probably damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Hydin A G 8: 110,509,127 probably benign Het
Ints5 G T 19: 8,897,133 V819L possibly damaging Het
Klhdc10 C G 6: 30,450,670 Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,479 A67T probably benign Het
Lrp1 T G 10: 127,594,969 T404P probably damaging Het
March7 T C 2: 60,234,126 S249P probably benign Het
Mcm10 T A 2: 5,008,623 K66M probably benign Het
Mtmr7 C A 8: 40,551,601 D645Y probably damaging Het
Muc6 T A 7: 141,636,955 I2602F possibly damaging Het
Myh13 G A 11: 67,369,295 probably benign Het
Myo18a G A 11: 77,850,806 V1776I possibly damaging Het
Ncapg2 T C 12: 116,443,075 L957S probably damaging Het
Ncoa3 T C 2: 166,054,502 S442P probably damaging Het
Olfr1093 G A 2: 86,785,735 E2K probably benign Het
Olfr850 T A 9: 19,477,480 T257S possibly damaging Het
Olfr986 G A 9: 40,187,433 G106D probably damaging Het
Pfkfb4 C T 9: 109,027,742 probably benign Het
Pfkm A G 15: 98,126,314 H401R probably benign Het
Phldb2 C A 16: 45,781,451 D754Y probably damaging Het
Plekhb2 T A 1: 34,863,114 M49K probably damaging Het
Polrmt A G 10: 79,737,611 S1057P possibly damaging Het
Prps1l1 A G 12: 34,985,078 N64S probably benign Het
Psg16 T C 7: 17,130,658 S393P probably benign Het
Rundc1 C T 11: 101,425,147 T15I probably benign Het
Scaf11 A G 15: 96,431,816 L143S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpinf1 T G 11: 75,413,945 I197L probably benign Het
Siglec1 C T 2: 131,074,525 probably benign Het
Slc28a1 G A 7: 81,138,177 V271I probably benign Het
Sntg1 T C 1: 8,782,824 D34G probably damaging Het
Sptbn4 A T 7: 27,359,736 probably benign Het
Suclg1 T C 6: 73,256,228 I51T possibly damaging Het
Syne1 C T 10: 5,541,989 R9Q probably damaging Het
Trim47 T A 11: 116,106,518 H470L probably damaging Het
Ttc41 T A 10: 86,712,977 Y12N possibly damaging Het
Tubgcp2 T C 7: 140,032,192 E69G probably damaging Het
Tubgcp3 G A 8: 12,641,116 T474M probably damaging Het
Ubr5 A T 15: 38,018,957 N777K probably benign Het
Ush2a T C 1: 188,451,819 L1440P probably damaging Het
Usp28 A C 9: 49,024,067 D458A possibly damaging Het
Vcan A T 13: 89,703,546 D1098E probably damaging Het
Vmn1r73 C T 7: 11,756,846 T197I probably benign Het
Vmn2r15 T C 5: 109,286,478 S787G probably damaging Het
Vmn2r90 T A 17: 17,728,139 I549N probably damaging Het
Vps33b T A 7: 80,283,414 probably null Het
Zfp516 A T 18: 82,987,670 K900* probably null Het
Zfp974 T A 7: 27,910,932 N456I probably damaging Het
Other mutations in Pdcd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02573:Pdcd6 APN 13 74303979 missense probably damaging 1.00
IGL03029:Pdcd6 APN 13 74309780 missense probably damaging 1.00
R0744:Pdcd6 UTSW 13 74316324 splice site probably benign
R0833:Pdcd6 UTSW 13 74316324 splice site probably benign
R1739:Pdcd6 UTSW 13 74304041 missense probably damaging 1.00
R1779:Pdcd6 UTSW 13 74305581 missense probably damaging 0.99
R1983:Pdcd6 UTSW 13 74304000 missense probably benign 0.05
R4665:Pdcd6 UTSW 13 74317206 start codon destroyed probably null 0.02
R5868:Pdcd6 UTSW 13 74304014 missense probably damaging 1.00
R6329:Pdcd6 UTSW 13 74303979 missense probably damaging 1.00
R6848:Pdcd6 UTSW 13 74309840 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TGGATGAAACACTGTGTGAAAGACTCC -3'
(R):5'- TGAACATGCAAACTTAATGTGTGCCTG -3'

Sequencing Primer
(F):5'- CACTGTGTGAAAGACTCCATGTC -3'
(R):5'- TTAATGTGTGCCTGCTATTTTATTTC -3'
Posted On2013-04-24