Incidental Mutation 'R3900:Zfp248'
ID308930
Institutional Source Beutler Lab
Gene Symbol Zfp248
Ensembl Gene ENSMUSG00000030145
Gene Namezinc finger protein 248
SynonymsE130106N01Rik, 2810037F07Rik
MMRRC Submission 041607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3900 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location118427319-118455528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118429566 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 253 (N253S)
Ref Sequence ENSEMBL: ENSMUSP00000124539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069292] [ENSMUST00000159403] [ENSMUST00000161519]
Predicted Effect probably damaging
Transcript: ENSMUST00000069292
AA Change: N354S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068807
Gene: ENSMUSG00000030145
AA Change: N354S

DomainStartEndE-ValueType
KRAB 8 68 2.4e-35 SMART
internal_repeat_1 209 375 2.52e-18 PROSPERO
ZnF_C2H2 377 399 3.89e-3 SMART
ZnF_C2H2 405 427 3.95e-4 SMART
ZnF_C2H2 433 455 4.24e-4 SMART
ZnF_C2H2 461 483 8.94e-3 SMART
ZnF_C2H2 489 511 8.47e-4 SMART
ZnF_C2H2 517 539 8.02e-5 SMART
ZnF_C2H2 545 567 6.52e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159403
Predicted Effect probably damaging
Transcript: ENSMUST00000161519
AA Change: N253S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124539
Gene: ENSMUSG00000030145
AA Change: N253S

DomainStartEndE-ValueType
Pfam:zf-C2H2_6 165 188 3.3e-2 PFAM
ZnF_C2H2 276 298 3.89e-3 SMART
ZnF_C2H2 304 326 3.95e-4 SMART
ZnF_C2H2 332 354 4.24e-4 SMART
ZnF_C2H2 360 382 8.94e-3 SMART
ZnF_C2H2 388 410 8.47e-4 SMART
ZnF_C2H2 416 438 8.02e-5 SMART
ZnF_C2H2 444 466 6.52e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175338
Meta Mutation Damage Score 0.3831 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A T 13: 54,552,968 S212R probably damaging Het
AI182371 T C 2: 35,085,216 I334V probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apc2 C A 10: 80,295,972 probably null Het
Bcl6 T G 16: 23,977,554 E41A possibly damaging Het
Brpf1 A G 6: 113,318,433 I674V probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cluh A G 11: 74,667,104 H1056R probably benign Het
Csgalnact2 A T 6: 118,121,014 F122I probably damaging Het
Cubn C A 2: 13,286,980 probably null Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Eif2ak4 A G 2: 118,475,029 Y1561C probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Eml5 G A 12: 98,825,523 R1245C probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm6133 A G 18: 78,350,150 N120D probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T C 1: 172,489,558 L35P probably damaging Het
Khdc3 T C 9: 73,104,346 probably benign Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mrgpra1 G T 7: 47,335,527 R135S possibly damaging Het
Olfr1201 A T 2: 88,794,929 L182F possibly damaging Het
Olfr971 A G 9: 39,839,402 probably null Het
Otud3 T C 4: 138,896,885 N282S probably benign Het
Prkar1a A G 11: 109,661,075 K130R probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Rictor T G 15: 6,789,473 D1392E probably benign Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc22a18 C A 7: 143,479,770 A86E probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Smoc1 T C 12: 81,167,513 V234A probably damaging Het
Stard9 A G 2: 120,713,549 T4443A possibly damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Trim69 A G 2: 122,178,841 T461A probably benign Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Ubr4 T C 4: 139,479,062 probably null Het
Ubr5 T C 15: 38,019,242 D752G probably damaging Het
Urb1 A T 16: 90,783,376 I633N possibly damaging Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Wdr6 G A 9: 108,575,769 A305V probably damaging Het
Other mutations in Zfp248
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Zfp248 APN 6 118429732 missense probably damaging 1.00
IGL02268:Zfp248 APN 6 118453840 intron probably benign
R1374:Zfp248 UTSW 6 118433373 missense probably damaging 1.00
R1678:Zfp248 UTSW 6 118429804 missense probably benign 0.02
R1794:Zfp248 UTSW 6 118429303 missense probably damaging 1.00
R1834:Zfp248 UTSW 6 118428970 missense probably damaging 0.98
R3948:Zfp248 UTSW 6 118430194 frame shift probably null
R4661:Zfp248 UTSW 6 118433307 missense possibly damaging 0.84
R4810:Zfp248 UTSW 6 118429846 missense possibly damaging 0.68
R4924:Zfp248 UTSW 6 118429072 missense probably damaging 1.00
R4926:Zfp248 UTSW 6 118429826 missense possibly damaging 0.74
R7326:Zfp248 UTSW 6 118430209 missense probably damaging 1.00
R7357:Zfp248 UTSW 6 118429657 missense probably damaging 1.00
R7910:Zfp248 UTSW 6 118430142 missense possibly damaging 0.93
R7991:Zfp248 UTSW 6 118430142 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTGAAGGTCTTCCCACACAC -3'
(R):5'- CGAGCGTAACGAATATGAGAAACTC -3'

Sequencing Primer
(F):5'- GGTTTGACTTGACACAGAACGTC -3'
(R):5'- GAAACTCTTCTGTGACGGTACAGC -3'
Posted On2015-04-17