Incidental Mutation 'R3900:Cherp'
ID308935
Institutional Source Beutler Lab
Gene Symbol Cherp
Ensembl Gene ENSMUSG00000052488
Gene Namecalcium homeostasis endoplasmic reticulum protein
SynonymsDAN16, SCAF6, D8Wsu96e, 5730408I11Rik
MMRRC Submission 041607-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R3900 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72460489-72475226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72469936 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 201 (I201T)
Ref Sequence ENSEMBL: ENSMUSP00000148273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079510] [ENSMUST00000212991]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079510
AA Change: I201T

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000078469
Gene: ENSMUSG00000052488
AA Change: I201T

DomainStartEndE-ValueType
SWAP 13 65 9.76e-24 SMART
low complexity region 78 100 N/A INTRINSIC
low complexity region 107 124 N/A INTRINSIC
RPR 156 286 5.32e-2 SMART
coiled coil region 310 334 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 409 419 N/A INTRINSIC
low complexity region 439 463 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
low complexity region 526 560 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
low complexity region 743 829 N/A INTRINSIC
G_patch 850 900 9.8e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212870
Predicted Effect possibly damaging
Transcript: ENSMUST00000212991
AA Change: I201T

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.5277 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A T 13: 54,552,968 S212R probably damaging Het
AI182371 T C 2: 35,085,216 I334V probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apc2 C A 10: 80,295,972 probably null Het
Bcl6 T G 16: 23,977,554 E41A possibly damaging Het
Brpf1 A G 6: 113,318,433 I674V probably benign Het
Cluh A G 11: 74,667,104 H1056R probably benign Het
Csgalnact2 A T 6: 118,121,014 F122I probably damaging Het
Cubn C A 2: 13,286,980 probably null Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Eif2ak4 A G 2: 118,475,029 Y1561C probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Eml5 G A 12: 98,825,523 R1245C probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm6133 A G 18: 78,350,150 N120D probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T C 1: 172,489,558 L35P probably damaging Het
Khdc3 T C 9: 73,104,346 probably benign Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mrgpra1 G T 7: 47,335,527 R135S possibly damaging Het
Olfr1201 A T 2: 88,794,929 L182F possibly damaging Het
Olfr971 A G 9: 39,839,402 probably null Het
Otud3 T C 4: 138,896,885 N282S probably benign Het
Prkar1a A G 11: 109,661,075 K130R probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Rictor T G 15: 6,789,473 D1392E probably benign Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc22a18 C A 7: 143,479,770 A86E probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Smoc1 T C 12: 81,167,513 V234A probably damaging Het
Stard9 A G 2: 120,713,549 T4443A possibly damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Trim69 A G 2: 122,178,841 T461A probably benign Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Ubr4 T C 4: 139,479,062 probably null Het
Ubr5 T C 15: 38,019,242 D752G probably damaging Het
Urb1 A T 16: 90,783,376 I633N possibly damaging Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Wdr6 G A 9: 108,575,769 A305V probably damaging Het
Zfp248 T C 6: 118,429,566 N253S probably damaging Het
Other mutations in Cherp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Cherp APN 8 72468246 missense probably damaging 0.97
IGL00955:Cherp APN 8 72470194 missense probably damaging 0.99
R0452:Cherp UTSW 8 72461522 unclassified probably benign
R0479:Cherp UTSW 8 72463147 missense possibly damaging 0.66
R0594:Cherp UTSW 8 72462402 critical splice donor site probably null
R1734:Cherp UTSW 8 72470088 critical splice donor site probably null
R1781:Cherp UTSW 8 72467771 missense probably damaging 1.00
R1793:Cherp UTSW 8 72463150 missense probably benign 0.12
R2012:Cherp UTSW 8 72474769 missense probably damaging 0.98
R2845:Cherp UTSW 8 72466403 missense probably damaging 0.99
R3612:Cherp UTSW 8 72461996 unclassified probably benign
R3693:Cherp UTSW 8 72467911 small deletion probably benign
R3899:Cherp UTSW 8 72469936 missense possibly damaging 0.63
R3970:Cherp UTSW 8 72469951 missense possibly damaging 0.60
R4915:Cherp UTSW 8 72468397 missense probably damaging 1.00
R5512:Cherp UTSW 8 72463266 missense possibly damaging 0.66
R5556:Cherp UTSW 8 72467980 missense probably damaging 0.99
R5739:Cherp UTSW 8 72467815 small deletion probably benign
R5768:Cherp UTSW 8 72463113 missense probably damaging 0.98
R5824:Cherp UTSW 8 72462258 unclassified probably benign
R5963:Cherp UTSW 8 72461535 unclassified probably benign
R6255:Cherp UTSW 8 72470881 missense probably damaging 0.99
R7145:Cherp UTSW 8 72468386 missense
R7538:Cherp UTSW 8 72462419 missense
R7578:Cherp UTSW 8 72464258 missense
RF001:Cherp UTSW 8 72462049 frame shift probably null
RF007:Cherp UTSW 8 72462059 small deletion probably benign
RF036:Cherp UTSW 8 72462044 frame shift probably null
RF036:Cherp UTSW 8 72462047 frame shift probably null
RF059:Cherp UTSW 8 72462055 frame shift probably null
T0722:Cherp UTSW 8 72462034 small deletion probably benign
T0975:Cherp UTSW 8 72462034 small deletion probably benign
Z1176:Cherp UTSW 8 72470953
Z1177:Cherp UTSW 8 72462916
Z1177:Cherp UTSW 8 72475135
Predicted Primers PCR Primer
(F):5'- ACTGTCCTGGGAGTACAAGC -3'
(R):5'- AGCGAGTTTGACAACCTGCTAC -3'

Sequencing Primer
(F):5'- TACAAGCAGTGAACCAGTGTGC -3'
(R):5'- TTGACACCTGCACAAAGGATG -3'
Posted On2015-04-17