Incidental Mutation 'R3900:Wdr6'
ID308939
Institutional Source Beutler Lab
Gene Symbol Wdr6
Ensembl Gene ENSMUSG00000066357
Gene NameWD repeat domain 6
Synonyms
MMRRC Submission 041607-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R3900 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108572311-108578739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108575769 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 305 (A305V)
Ref Sequence ENSEMBL: ENSMUSP00000070927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006853] [ENSMUST00000019183] [ENSMUST00000068700] [ENSMUST00000193427] [ENSMUST00000195249]
Predicted Effect probably benign
Transcript: ENSMUST00000006853
SMART Domains Protein: ENSMUSP00000006853
Gene: ENSMUSG00000006675

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
P4Hc 143 460 1.26e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019183
SMART Domains Protein: ENSMUSP00000019183
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 288 301 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
DALR_1 399 538 2.09e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068700
AA Change: A305V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070927
Gene: ENSMUSG00000066357
AA Change: A305V

DomainStartEndE-ValueType
Blast:WD40 109 142 3e-6 BLAST
WD40 198 237 1.42e-4 SMART
WD40 247 284 7.28e-2 SMART
WD40 286 326 1.72e-3 SMART
Blast:WD40 336 375 3e-13 BLAST
WD40 479 519 2.96e1 SMART
low complexity region 537 552 N/A INTRINSIC
WD40 559 598 1.77e2 SMART
Blast:WD40 600 641 7e-20 BLAST
Blast:WD40 764 815 2e-22 BLAST
Blast:WD40 855 896 2e-11 BLAST
WD40 900 949 1.48e1 SMART
WD40 973 1015 5.52e-2 SMART
WD40 1035 1076 3.98e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191897
Predicted Effect probably benign
Transcript: ENSMUST00000192518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192651
Predicted Effect probably benign
Transcript: ENSMUST00000193427
SMART Domains Protein: ENSMUSP00000141748
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
DALR_1 68 171 1.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194900
Predicted Effect probably benign
Transcript: ENSMUST00000195249
Meta Mutation Damage Score 0.1676 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. The encoded protein interacts with serine/threonine kinase 11, and is implicated in cell growth arrest. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A T 13: 54,552,968 S212R probably damaging Het
AI182371 T C 2: 35,085,216 I334V probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apc2 C A 10: 80,295,972 probably null Het
Bcl6 T G 16: 23,977,554 E41A possibly damaging Het
Brpf1 A G 6: 113,318,433 I674V probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cluh A G 11: 74,667,104 H1056R probably benign Het
Csgalnact2 A T 6: 118,121,014 F122I probably damaging Het
Cubn C A 2: 13,286,980 probably null Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Eif2ak4 A G 2: 118,475,029 Y1561C probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Eml5 G A 12: 98,825,523 R1245C probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm6133 A G 18: 78,350,150 N120D probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T C 1: 172,489,558 L35P probably damaging Het
Khdc3 T C 9: 73,104,346 probably benign Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mrgpra1 G T 7: 47,335,527 R135S possibly damaging Het
Olfr1201 A T 2: 88,794,929 L182F possibly damaging Het
Olfr971 A G 9: 39,839,402 probably null Het
Otud3 T C 4: 138,896,885 N282S probably benign Het
Prkar1a A G 11: 109,661,075 K130R probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Rictor T G 15: 6,789,473 D1392E probably benign Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc22a18 C A 7: 143,479,770 A86E probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Smoc1 T C 12: 81,167,513 V234A probably damaging Het
Stard9 A G 2: 120,713,549 T4443A possibly damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Trim69 A G 2: 122,178,841 T461A probably benign Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Ubr4 T C 4: 139,479,062 probably null Het
Ubr5 T C 15: 38,019,242 D752G probably damaging Het
Urb1 A T 16: 90,783,376 I633N possibly damaging Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Zfp248 T C 6: 118,429,566 N253S probably damaging Het
Other mutations in Wdr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Wdr6 APN 9 108574897 missense possibly damaging 0.77
IGL01757:Wdr6 APN 9 108576228 missense possibly damaging 0.65
IGL02096:Wdr6 APN 9 108576553 missense probably damaging 1.00
IGL02577:Wdr6 APN 9 108575941 missense possibly damaging 0.88
IGL02625:Wdr6 APN 9 108575505 missense probably damaging 1.00
IGL02820:Wdr6 APN 9 108578544 missense probably benign 0.28
IGL03250:Wdr6 APN 9 108573197 missense possibly damaging 0.95
PIT4802001:Wdr6 UTSW 9 108574566 missense probably damaging 1.00
R0038:Wdr6 UTSW 9 108572969 missense probably damaging 1.00
R0153:Wdr6 UTSW 9 108575242 missense probably damaging 1.00
R0378:Wdr6 UTSW 9 108575864 missense probably damaging 1.00
R0420:Wdr6 UTSW 9 108573101 missense probably benign 0.41
R1620:Wdr6 UTSW 9 108574655 missense possibly damaging 0.51
R1753:Wdr6 UTSW 9 108575164 missense probably damaging 0.99
R1844:Wdr6 UTSW 9 108575977 missense probably damaging 1.00
R1881:Wdr6 UTSW 9 108573179 unclassified probably null
R1987:Wdr6 UTSW 9 108576534 missense probably damaging 1.00
R2029:Wdr6 UTSW 9 108575355 missense probably damaging 1.00
R2139:Wdr6 UTSW 9 108574123 missense probably benign 0.00
R4021:Wdr6 UTSW 9 108575206 missense probably damaging 1.00
R4909:Wdr6 UTSW 9 108572988 missense probably benign 0.28
R5073:Wdr6 UTSW 9 108574366 missense probably damaging 1.00
R5748:Wdr6 UTSW 9 108575782 missense possibly damaging 0.75
R6039:Wdr6 UTSW 9 108573795 frame shift probably null
R6039:Wdr6 UTSW 9 108573795 frame shift probably null
R6254:Wdr6 UTSW 9 108574911 missense probably damaging 1.00
R6724:Wdr6 UTSW 9 108574894 missense probably benign 0.11
R7134:Wdr6 UTSW 9 108573365 missense probably damaging 1.00
R7248:Wdr6 UTSW 9 108576039 missense possibly damaging 0.82
R7296:Wdr6 UTSW 9 108574585 missense probably damaging 1.00
R7388:Wdr6 UTSW 9 108574772 missense probably damaging 1.00
R7443:Wdr6 UTSW 9 108574290 missense probably damaging 1.00
R7467:Wdr6 UTSW 9 108573002 missense probably benign 0.14
R7672:Wdr6 UTSW 9 108573748 missense probably benign 0.06
R7699:Wdr6 UTSW 9 108576361 missense possibly damaging 0.92
R7700:Wdr6 UTSW 9 108576361 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACATCAGTCACTGCCAGGAC -3'
(R):5'- AAGTGTTCGTCTCTGGAAGG -3'

Sequencing Primer
(F):5'- AGGACTCGCCAGGAACCAG -3'
(R):5'- CTCTGGAAGGTGGGGGAC -3'
Posted On2015-04-17