Incidental Mutation 'R3900:4833439L19Rik'
ID308953
Institutional Source Beutler Lab
Gene Symbol 4833439L19Rik
Ensembl Gene ENSMUSG00000025871
Gene NameRIKEN cDNA 4833439L19 gene
Synonyms
MMRRC Submission 041607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R3900 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location54551218-54565435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54552968 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 212 (S212R)
Ref Sequence ENSEMBL: ENSMUSP00000026989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026989] [ENSMUST00000118072] [ENSMUST00000121401] [ENSMUST00000143144] [ENSMUST00000153065]
Predicted Effect probably damaging
Transcript: ENSMUST00000026989
AA Change: S212R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026989
Gene: ENSMUSG00000025871
AA Change: S212R

DomainStartEndE-ValueType
Pfam:P33MONOX 15 303 5.8e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118072
SMART Domains Protein: ENSMUSP00000112376
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 167 179 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
low complexity region 425 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121401
SMART Domains Protein: ENSMUSP00000113676
Gene: ENSMUSG00000043183

DomainStartEndE-ValueType
low complexity region 11 34 N/A INTRINSIC
low complexity region 173 189 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 249 263 N/A INTRINSIC
internal_repeat_1 268 491 3.21e-17 PROSPERO
internal_repeat_1 579 832 3.21e-17 PROSPERO
low complexity region 852 868 N/A INTRINSIC
low complexity region 1068 1080 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1326 1344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126506
Predicted Effect probably benign
Transcript: ENSMUST00000143144
SMART Domains Protein: ENSMUSP00000120615
Gene: ENSMUSG00000025871

DomainStartEndE-ValueType
Pfam:P33MONOX 14 133 9.7e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150938
Predicted Effect possibly damaging
Transcript: ENSMUST00000153065
AA Change: S193R

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119874
Gene: ENSMUSG00000025871
AA Change: S193R

DomainStartEndE-ValueType
Pfam:P33MONOX 1 284 7e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153708
Meta Mutation Damage Score 0.0661 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T C 2: 35,085,216 I334V probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apc2 C A 10: 80,295,972 probably null Het
Bcl6 T G 16: 23,977,554 E41A possibly damaging Het
Brpf1 A G 6: 113,318,433 I674V probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cluh A G 11: 74,667,104 H1056R probably benign Het
Csgalnact2 A T 6: 118,121,014 F122I probably damaging Het
Cubn C A 2: 13,286,980 probably null Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Eif2ak4 A G 2: 118,475,029 Y1561C probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Eml5 G A 12: 98,825,523 R1245C probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm6133 A G 18: 78,350,150 N120D probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T C 1: 172,489,558 L35P probably damaging Het
Khdc3 T C 9: 73,104,346 probably benign Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mrgpra1 G T 7: 47,335,527 R135S possibly damaging Het
Olfr1201 A T 2: 88,794,929 L182F possibly damaging Het
Olfr971 A G 9: 39,839,402 probably null Het
Otud3 T C 4: 138,896,885 N282S probably benign Het
Prkar1a A G 11: 109,661,075 K130R probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Rictor T G 15: 6,789,473 D1392E probably benign Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc22a18 C A 7: 143,479,770 A86E probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Smoc1 T C 12: 81,167,513 V234A probably damaging Het
Stard9 A G 2: 120,713,549 T4443A possibly damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Trim69 A G 2: 122,178,841 T461A probably benign Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Ubr4 T C 4: 139,479,062 probably null Het
Ubr5 T C 15: 38,019,242 D752G probably damaging Het
Urb1 A T 16: 90,783,376 I633N possibly damaging Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Wdr6 G A 9: 108,575,769 A305V probably damaging Het
Zfp248 T C 6: 118,429,566 N253S probably damaging Het
Other mutations in 4833439L19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:4833439L19Rik APN 13 54556525 critical splice donor site probably null
IGL02819:4833439L19Rik APN 13 54564220 intron probably benign
IGL02935:4833439L19Rik APN 13 54561862 missense possibly damaging 0.90
R0508:4833439L19Rik UTSW 13 54553050 unclassified probably null
R5091:4833439L19Rik UTSW 13 54553244 missense probably damaging 1.00
R5737:4833439L19Rik UTSW 13 54559242 missense probably damaging 0.99
R7283:4833439L19Rik UTSW 13 54552691 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CACCTTTGTAAGCCTGAATAGC -3'
(R):5'- AGAAGTCCAGGTCAGTCTCC -3'

Sequencing Primer
(F):5'- TGTAAGCCTGAATAGCAAAACCTG -3'
(R):5'- CCAGTGCTGAGATGCTGCTG -3'
Posted On2015-04-17