Incidental Mutation 'R3901:Pogk'
ID308964
Institutional Source Beutler Lab
Gene Symbol Pogk
Ensembl Gene ENSMUSG00000040596
Gene Namepogo transposable element with KRAB domain
SynonymsBASS2, 9130401E23Rik
MMRRC Submission 040810-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R3901 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location166384622-166409863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 166403624 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 45 (V45I)
Ref Sequence ENSEMBL: ENSMUSP00000120963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127596] [ENSMUST00000128861] [ENSMUST00000131487] [ENSMUST00000135673] [ENSMUST00000148243] [ENSMUST00000169324]
Predicted Effect probably damaging
Transcript: ENSMUST00000127596
AA Change: V45I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120963
Gene: ENSMUSG00000040596
AA Change: V45I

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 105 6.31e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000128861
AA Change: V52I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118270
Gene: ENSMUSG00000040596
AA Change: V52I

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 107 1.53e-19 SMART
Pfam:BrkDBD 195 247 2.1e-29 PFAM
CENPB 256 323 3.93e-21 SMART
Pfam:DDE_1 355 567 1.4e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131487
AA Change: V52I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116477
Gene: ENSMUSG00000040596
AA Change: V52I

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 107 1.53e-19 SMART
Pfam:BrkDBD 195 247 2.1e-29 PFAM
CENPB 256 323 3.93e-21 SMART
Pfam:DDE_1 355 567 1.4e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135673
AA Change: V64I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120352
Gene: ENSMUSG00000040596
AA Change: V64I

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 107 1.53e-19 SMART
Pfam:BrkDBD 195 247 2.1e-29 PFAM
CENPB 256 323 3.93e-21 SMART
Pfam:DDE_1 355 567 1.4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148243
SMART Domains Protein: ENSMUSP00000118877
Gene: ENSMUSG00000040596

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169324
AA Change: V64I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127395
Gene: ENSMUSG00000040596
AA Change: V64I

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
KRAB 66 126 1.53e-19 SMART
Pfam:BrkDBD 214 266 8.7e-29 PFAM
CENPB 275 342 3.93e-21 SMART
Pfam:DDE_1 414 586 1.5e-48 PFAM
Meta Mutation Damage Score 0.1971 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of the protein encoded by this gene is not known. However, this gene product contains a KRAB domain (which is involved in protein-protein interactions) at the N-terminus, and a transposase domain at the C-terminus, suggesting that it may belong to the family of DNA-mediated transposons in human. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adamts20 T A 15: 94,328,845 D1109V possibly damaging Het
Apc2 G C 10: 80,315,088 R1992P possibly damaging Het
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Casp16-ps A T 17: 23,552,948 V101E probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Clec7a A G 6: 129,468,914 S98P possibly damaging Het
Cpne5 G A 17: 29,159,108 R566C unknown Het
Csrnp1 C T 9: 119,972,641 E451K probably damaging Het
Dlst A G 12: 85,132,691 T435A possibly damaging Het
Dock8 A G 19: 25,100,905 T525A possibly damaging Het
Dync2li1 A G 17: 84,631,642 T45A probably damaging Het
Efcab3 A G 11: 105,083,887 N5307S possibly damaging Het
Epha4 A G 1: 77,380,902 Y820H probably damaging Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbn2 T A 18: 58,066,011 N1395I probably damaging Het
Fcnb T A 2: 28,079,196 Y163F probably damaging Het
Gm5444 T C 13: 4,834,279 noncoding transcript Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Kcnj3 A G 2: 55,437,348 N50D possibly damaging Het
Kcnma1 A G 14: 23,505,255 I416T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Lama5 C T 2: 180,182,351 probably benign Het
Lrp1b A G 2: 40,822,695 V3095A probably damaging Het
Mmp1a A G 9: 7,475,345 *372W probably null Het
Olfr867 C T 9: 20,054,873 V197I probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Pgap1 C T 1: 54,493,348 V671I probably benign Het
Pla2g4e T C 2: 120,168,604 S760G probably benign Het
Plk3 T C 4: 117,133,436 I94V probably benign Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Rims1 T A 1: 22,533,497 Q541L probably benign Het
Rptn A G 3: 93,398,357 Q999R probably benign Het
Stxbp5 A G 10: 9,769,419 L911P probably damaging Het
Tgfbr3 A G 5: 107,214,887 probably benign Het
Trim7 A T 11: 48,837,608 T28S probably damaging Het
Zfp595 T C 13: 67,317,315 I295V probably benign Het
Other mutations in Pogk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Pogk APN 1 166408478 missense probably damaging 1.00
R0395:Pogk UTSW 1 166403602 missense probably damaging 1.00
R1387:Pogk UTSW 1 166400138 missense possibly damaging 0.85
R1556:Pogk UTSW 1 166398833 missense possibly damaging 0.59
R1752:Pogk UTSW 1 166408428 missense probably damaging 0.96
R3625:Pogk UTSW 1 166403512 missense probably damaging 1.00
R3902:Pogk UTSW 1 166403624 missense probably damaging 1.00
R4288:Pogk UTSW 1 166403506 missense probably damaging 1.00
R4612:Pogk UTSW 1 166398765 nonsense probably null
R5079:Pogk UTSW 1 166399164 missense probably damaging 1.00
R5788:Pogk UTSW 1 166409011 intron probably benign
R6488:Pogk UTSW 1 166399422 missense possibly damaging 0.79
R6708:Pogk UTSW 1 166403509 missense probably damaging 1.00
R7603:Pogk UTSW 1 166401911 missense probably benign 0.03
X0010:Pogk UTSW 1 166398797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACACTGATGAATGTCTCTGGG -3'
(R):5'- ACATCTCATGCAATCAGTACCTG -3'

Sequencing Primer
(F):5'- GTTTGGAGAGTCCCAGAGAC -3'
(R):5'- TCAGTACCTGATGATGCCCAG -3'
Posted On2015-04-17