Incidental Mutation 'R3901:Cass4'
ID308970
Institutional Source Beutler Lab
Gene Symbol Cass4
Ensembl Gene ENSMUSG00000074570
Gene NameCas scaffolding protein family member 4
SynonymsF730031O20Rik
MMRRC Submission 040810-MU
Accession Numbers

Ncbi RefSeq: NM_001033538.2, NM_001080820.1; MGI:2444482

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3901 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172393794-172433757 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 172432558 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 753 (P753L)
Ref Sequence ENSEMBL: ENSMUSP00000154073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099061] [ENSMUST00000103073] [ENSMUST00000109136] [ENSMUST00000228775]
Predicted Effect probably benign
Transcript: ENSMUST00000099061
SMART Domains Protein: ENSMUSP00000096660
Gene: ENSMUSG00000074570

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 591 4.2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103073
AA Change: P751L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099362
Gene: ENSMUSG00000074570
AA Change: P751L

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 591 7.5e-69 PFAM
Pfam:DUF3513 587 778 8.8e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109136
AA Change: P777L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104764
Gene: ENSMUSG00000074570
AA Change: P777L

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 589 3.8e-58 PFAM
Pfam:DUF3513 593 803 1.6e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138288
Predicted Effect probably damaging
Transcript: ENSMUST00000228775
AA Change: P753L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3954 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (39/40)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adamts20 T A 15: 94,328,845 D1109V possibly damaging Het
Apc2 G C 10: 80,315,088 R1992P possibly damaging Het
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Casp16-ps A T 17: 23,552,948 V101E probably damaging Het
Clec7a A G 6: 129,468,914 S98P possibly damaging Het
Cpne5 G A 17: 29,159,108 R566C unknown Het
Csrnp1 C T 9: 119,972,641 E451K probably damaging Het
Dlst A G 12: 85,132,691 T435A possibly damaging Het
Dock8 A G 19: 25,100,905 T525A possibly damaging Het
Dync2li1 A G 17: 84,631,642 T45A probably damaging Het
Efcab3 A G 11: 105,083,887 N5307S possibly damaging Het
Epha4 A G 1: 77,380,902 Y820H probably damaging Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbn2 T A 18: 58,066,011 N1395I probably damaging Het
Fcnb T A 2: 28,079,196 Y163F probably damaging Het
Gm5444 T C 13: 4,834,279 noncoding transcript Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Kcnj3 A G 2: 55,437,348 N50D possibly damaging Het
Kcnma1 A G 14: 23,505,255 I416T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Lama5 C T 2: 180,182,351 probably benign Het
Lrp1b A G 2: 40,822,695 V3095A probably damaging Het
Mmp1a A G 9: 7,475,345 *372W probably null Het
Olfr867 C T 9: 20,054,873 V197I probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Pgap1 C T 1: 54,493,348 V671I probably benign Het
Pla2g4e T C 2: 120,168,604 S760G probably benign Het
Plk3 T C 4: 117,133,436 I94V probably benign Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Rims1 T A 1: 22,533,497 Q541L probably benign Het
Rptn A G 3: 93,398,357 Q999R probably benign Het
Stxbp5 A G 10: 9,769,419 L911P probably damaging Het
Tgfbr3 A G 5: 107,214,887 probably benign Het
Trim7 A T 11: 48,837,608 T28S probably damaging Het
Zfp595 T C 13: 67,317,315 I295V probably benign Het
Other mutations in Cass4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cass4 APN 2 172416250 missense probably damaging 1.00
IGL00846:Cass4 APN 2 172429723 intron probably benign
IGL01400:Cass4 APN 2 172427300 missense probably damaging 1.00
IGL01985:Cass4 APN 2 172427206 missense probably damaging 1.00
IGL02268:Cass4 APN 2 172427042 missense possibly damaging 0.76
IGL02592:Cass4 APN 2 172416328 missense probably benign 0.00
R0030:Cass4 UTSW 2 172427842 nonsense probably null
R0035:Cass4 UTSW 2 172416492 missense probably damaging 1.00
R0039:Cass4 UTSW 2 172426980 missense probably damaging 1.00
R0631:Cass4 UTSW 2 172432411 missense probably damaging 1.00
R1321:Cass4 UTSW 2 172424652 missense probably benign 0.05
R1352:Cass4 UTSW 2 172416495 missense probably damaging 0.98
R1612:Cass4 UTSW 2 172427078 missense possibly damaging 0.46
R1720:Cass4 UTSW 2 172427734 missense probably damaging 0.99
R1776:Cass4 UTSW 2 172427695 missense probably benign
R1918:Cass4 UTSW 2 172427339 missense possibly damaging 0.69
R2257:Cass4 UTSW 2 172427470 missense probably damaging 1.00
R2257:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R2262:Cass4 UTSW 2 172427254 missense probably damaging 1.00
R2924:Cass4 UTSW 2 172426672 missense possibly damaging 0.89
R3498:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3499:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3792:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3793:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R4899:Cass4 UTSW 2 172427869 missense probably benign
R5161:Cass4 UTSW 2 172432324 missense probably damaging 1.00
R5534:Cass4 UTSW 2 172426768 missense probably benign 0.13
R5646:Cass4 UTSW 2 172416245 missense probably damaging 1.00
R5799:Cass4 UTSW 2 172416187 missense probably damaging 1.00
R5873:Cass4 UTSW 2 172426768 missense probably benign 0.13
R6084:Cass4 UTSW 2 172426912 missense probably benign 0.01
R6360:Cass4 UTSW 2 172432611 missense probably damaging 1.00
R6432:Cass4 UTSW 2 172427719 missense probably damaging 1.00
R7116:Cass4 UTSW 2 172427969 missense unknown
R7212:Cass4 UTSW 2 172427186 nonsense probably null
R7549:Cass4 UTSW 2 172426798 missense probably benign 0.01
R7549:Cass4 UTSW 2 172426799 missense probably benign 0.00
R7594:Cass4 UTSW 2 172429648 missense probably benign 0.03
R7659:Cass4 UTSW 2 172427027 missense probably damaging 1.00
R8003:Cass4 UTSW 2 172427959 missense unknown
R8270:Cass4 UTSW 2 172427669 missense probably damaging 1.00
R8296:Cass4 UTSW 2 172427174 missense probably benign 0.28
R8378:Cass4 UTSW 2 172427794 missense probably benign 0.05
Z1177:Cass4 UTSW 2 172427575 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCACTCAGAGCAAGCTAGTC -3'
(R):5'- AGGTCTTGACTTGTCGCCTG -3'

Sequencing Primer
(F):5'- AGCTAGTCATCACAGTTGGAC -3'
(R):5'- ACCTCGTGGTCAGTCAGTG -3'
Posted On2015-04-17