Incidental Mutation 'R3901:Tgfbr3'
ID308977
Institutional Source Beutler Lab
Gene Symbol Tgfbr3
Ensembl Gene ENSMUSG00000029287
Gene Nametransforming growth factor, beta receptor III
Synonymsbetaglycan, TBRIII, 1110036H20Rik
MMRRC Submission 040810-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3901 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107106570-107289629 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 107214887 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031224]
Predicted Effect probably benign
Transcript: ENSMUST00000031224
SMART Domains Protein: ENSMUSP00000031224
Gene: ENSMUSG00000029287

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
internal_repeat_1 64 193 2.48e-5 PROSPERO
internal_repeat_1 232 361 2.48e-5 PROSPERO
low complexity region 419 430 N/A INTRINSIC
ZP 454 731 8.12e-65 SMART
transmembrane domain 786 808 N/A INTRINSIC
low complexity region 835 849 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146591
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes the transforming growth factor (TGF)-beta type III receptor. The encoded receptor is a membrane proteoglycan that often functions as a co-receptor with other TGF-beta receptor superfamily members. Ectodomain shedding produces soluble TGFBR3, which may inhibit TGFB signaling. Decreased expression of this receptor has been observed in various cancers. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die as embryos. The very few individuals that survive are poorly fertile with abnormalities of the spleen, liver, heart, and skeletal system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adamts20 T A 15: 94,328,845 D1109V possibly damaging Het
Apc2 G C 10: 80,315,088 R1992P possibly damaging Het
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Casp16-ps A T 17: 23,552,948 V101E probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Clec7a A G 6: 129,468,914 S98P possibly damaging Het
Cpne5 G A 17: 29,159,108 R566C unknown Het
Csrnp1 C T 9: 119,972,641 E451K probably damaging Het
Dlst A G 12: 85,132,691 T435A possibly damaging Het
Dock8 A G 19: 25,100,905 T525A possibly damaging Het
Dync2li1 A G 17: 84,631,642 T45A probably damaging Het
Efcab3 A G 11: 105,083,887 N5307S possibly damaging Het
Epha4 A G 1: 77,380,902 Y820H probably damaging Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbn2 T A 18: 58,066,011 N1395I probably damaging Het
Fcnb T A 2: 28,079,196 Y163F probably damaging Het
Gm5444 T C 13: 4,834,279 noncoding transcript Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Kcnj3 A G 2: 55,437,348 N50D possibly damaging Het
Kcnma1 A G 14: 23,505,255 I416T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Lama5 C T 2: 180,182,351 probably benign Het
Lrp1b A G 2: 40,822,695 V3095A probably damaging Het
Mmp1a A G 9: 7,475,345 *372W probably null Het
Olfr867 C T 9: 20,054,873 V197I probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Pgap1 C T 1: 54,493,348 V671I probably benign Het
Pla2g4e T C 2: 120,168,604 S760G probably benign Het
Plk3 T C 4: 117,133,436 I94V probably benign Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Rims1 T A 1: 22,533,497 Q541L probably benign Het
Rptn A G 3: 93,398,357 Q999R probably benign Het
Stxbp5 A G 10: 9,769,419 L911P probably damaging Het
Trim7 A T 11: 48,837,608 T28S probably damaging Het
Zfp595 T C 13: 67,317,315 I295V probably benign Het
Other mutations in Tgfbr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Tgfbr3 APN 5 107142501 missense probably benign 0.00
IGL01135:Tgfbr3 APN 5 107215028 missense probably damaging 1.00
IGL01375:Tgfbr3 APN 5 107136971 missense probably benign
IGL01457:Tgfbr3 APN 5 107149898 missense probably damaging 1.00
IGL01599:Tgfbr3 APN 5 107118451 missense probably damaging 0.98
IGL01646:Tgfbr3 APN 5 107121413 splice site probably benign
IGL01945:Tgfbr3 APN 5 107121358 critical splice donor site probably null
IGL03039:Tgfbr3 APN 5 107177799 splice site probably benign
IGL03202:Tgfbr3 APN 5 107109764 splice site probably benign
IGL03378:Tgfbr3 APN 5 107109702 missense probably damaging 1.00
R0131:Tgfbr3 UTSW 5 107132816 missense probably benign 0.00
R0452:Tgfbr3 UTSW 5 107140423 missense probably benign 0.00
R0665:Tgfbr3 UTSW 5 107177850 missense probably benign 0.11
R0667:Tgfbr3 UTSW 5 107177850 missense probably benign 0.11
R0751:Tgfbr3 UTSW 5 107139883 missense probably damaging 1.00
R1373:Tgfbr3 UTSW 5 107214943 missense probably benign 0.01
R1777:Tgfbr3 UTSW 5 107136930 missense probably benign 0.31
R1887:Tgfbr3 UTSW 5 107137008 missense probably damaging 1.00
R3019:Tgfbr3 UTSW 5 107137546 missense possibly damaging 0.70
R3552:Tgfbr3 UTSW 5 107139839 missense probably damaging 0.99
R3617:Tgfbr3 UTSW 5 107140619 missense possibly damaging 0.65
R4830:Tgfbr3 UTSW 5 107109719 missense probably damaging 1.00
R4939:Tgfbr3 UTSW 5 107130469 missense probably benign
R5020:Tgfbr3 UTSW 5 107214970 missense probably damaging 1.00
R5044:Tgfbr3 UTSW 5 107136929 missense possibly damaging 0.88
R5619:Tgfbr3 UTSW 5 107140514 missense probably benign 0.23
R5752:Tgfbr3 UTSW 5 107139807 missense probably benign 0.01
R5768:Tgfbr3 UTSW 5 107149895 missense probably benign
R5799:Tgfbr3 UTSW 5 107109608 utr 3 prime probably benign
R5818:Tgfbr3 UTSW 5 107133003 missense probably benign
R5846:Tgfbr3 UTSW 5 107140655 missense possibly damaging 0.51
R5859:Tgfbr3 UTSW 5 107140515 missense probably benign 0.00
R6049:Tgfbr3 UTSW 5 107118485 missense probably damaging 0.99
R6378:Tgfbr3 UTSW 5 107177813 missense probably benign 0.00
R6696:Tgfbr3 UTSW 5 107136930 missense probably benign 0.02
R6823:Tgfbr3 UTSW 5 107149914 missense probably damaging 1.00
R6994:Tgfbr3 UTSW 5 107133026 missense probably damaging 1.00
R7454:Tgfbr3 UTSW 5 107215028 missense probably damaging 1.00
R7773:Tgfbr3 UTSW 5 107140502 missense probably benign 0.00
X0022:Tgfbr3 UTSW 5 107136926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTTAAGACACAGCAAGGCAG -3'
(R):5'- GTGTTCATAGGTCCAGAGCC -3'

Sequencing Primer
(F):5'- CAGGAGGAAAGAAGGGAAATGTGATC -3'
(R):5'- TAGGTCCAGAGCCCAGCAC -3'
Posted On2015-04-17