Incidental Mutation 'R3901:Brat1'
ID308978
Institutional Source Beutler Lab
Gene Symbol Brat1
Ensembl Gene ENSMUSG00000000148
Gene NameBRCA1-associated ATM activator 1
Synonyms
MMRRC Submission 040810-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R3901 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location140705011-140719379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 140717996 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 668 (D668A)
Ref Sequence ENSEMBL: ENSMUSP00000098074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041588] [ENSMUST00000100505] [ENSMUST00000110806] [ENSMUST00000153440]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041588
AA Change: D623A

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036016
Gene: ENSMUSG00000000148
AA Change: D623A

DomainStartEndE-ValueType
low complexity region 90 105 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Pfam:HEAT 501 531 3e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100505
AA Change: D668A

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098074
Gene: ENSMUSG00000000148
AA Change: D668A

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
low complexity region 135 150 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
low complexity region 488 499 N/A INTRINSIC
low complexity region 531 543 N/A INTRINSIC
Pfam:HEAT 546 576 4.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110806
SMART Domains Protein: ENSMUSP00000106429
Gene: ENSMUSG00000000148

DomainStartEndE-ValueType
low complexity region 90 105 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Pfam:HEAT 501 531 4.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131905
Predicted Effect probably benign
Transcript: ENSMUST00000153440
SMART Domains Protein: ENSMUSP00000114216
Gene: ENSMUSG00000000148

DomainStartEndE-ValueType
SCOP:d1gw5a_ 2 172 2e-3 SMART
Meta Mutation Damage Score 0.1651 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: A similar gene in human encodes a Breast Cancer 1 (BRCA1) interacting protein that is involved in cell cycle checkpoint signaling. The similar human protein is localized to DNA double strand breaks caused by ionizing radiation, and regulates cellular DNA damage response through interactions with Ataxia Telangiectasia Mutated (ATM) and DNA-dependent Protein Kinase. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adamts20 T A 15: 94,328,845 D1109V possibly damaging Het
Apc2 G C 10: 80,315,088 R1992P possibly damaging Het
Atmin A G 8: 116,956,297 N232S probably benign Het
Casp16-ps A T 17: 23,552,948 V101E probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Clec7a A G 6: 129,468,914 S98P possibly damaging Het
Cpne5 G A 17: 29,159,108 R566C unknown Het
Csrnp1 C T 9: 119,972,641 E451K probably damaging Het
Dlst A G 12: 85,132,691 T435A possibly damaging Het
Dock8 A G 19: 25,100,905 T525A possibly damaging Het
Dync2li1 A G 17: 84,631,642 T45A probably damaging Het
Efcab3 A G 11: 105,083,887 N5307S possibly damaging Het
Epha4 A G 1: 77,380,902 Y820H probably damaging Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbn2 T A 18: 58,066,011 N1395I probably damaging Het
Fcnb T A 2: 28,079,196 Y163F probably damaging Het
Gm5444 T C 13: 4,834,279 noncoding transcript Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Kcnj3 A G 2: 55,437,348 N50D possibly damaging Het
Kcnma1 A G 14: 23,505,255 I416T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Lama5 C T 2: 180,182,351 probably benign Het
Lrp1b A G 2: 40,822,695 V3095A probably damaging Het
Mmp1a A G 9: 7,475,345 *372W probably null Het
Olfr867 C T 9: 20,054,873 V197I probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Pgap1 C T 1: 54,493,348 V671I probably benign Het
Pla2g4e T C 2: 120,168,604 S760G probably benign Het
Plk3 T C 4: 117,133,436 I94V probably benign Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Rims1 T A 1: 22,533,497 Q541L probably benign Het
Rptn A G 3: 93,398,357 Q999R probably benign Het
Stxbp5 A G 10: 9,769,419 L911P probably damaging Het
Tgfbr3 A G 5: 107,214,887 probably benign Het
Trim7 A T 11: 48,837,608 T28S probably damaging Het
Zfp595 T C 13: 67,317,315 I295V probably benign Het
Other mutations in Brat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Brat1 APN 5 140717177 missense probably damaging 1.00
IGL01327:Brat1 APN 5 140718208 nonsense probably null
IGL01897:Brat1 APN 5 140717915 missense probably benign 0.00
IGL01965:Brat1 APN 5 140718056 missense probably benign 0.01
IGL02437:Brat1 APN 5 140712808 missense possibly damaging 0.91
IGL03350:Brat1 APN 5 140705995 missense probably damaging 1.00
R0394:Brat1 UTSW 5 140718386 missense probably damaging 1.00
R1256:Brat1 UTSW 5 140710207 missense possibly damaging 0.87
R1426:Brat1 UTSW 5 140718013 missense probably benign 0.00
R1474:Brat1 UTSW 5 140712627 missense probably benign
R1848:Brat1 UTSW 5 140718509 missense possibly damaging 0.94
R2205:Brat1 UTSW 5 140705133 intron probably benign
R3902:Brat1 UTSW 5 140717996 missense possibly damaging 0.77
R4467:Brat1 UTSW 5 140705071 utr 5 prime probably benign
R4751:Brat1 UTSW 5 140718296 missense probably damaging 1.00
R5795:Brat1 UTSW 5 140713072 missense probably benign 0.01
R6151:Brat1 UTSW 5 140705961 missense probably benign 0.00
R7162:Brat1 UTSW 5 140710249 missense probably benign 0.00
X0026:Brat1 UTSW 5 140714938 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATCACGGTCACTCAGAGGG -3'
(R):5'- CTGCAAGAATTCCGGGTGTG -3'

Sequencing Primer
(F):5'- ACTCAGAGGGCGGTCTCATAG -3'
(R):5'- AATTCCGGGTGTGGGCGG -3'
Posted On2015-04-17