Incidental Mutation 'R3901:Atmin'
ID308980
Institutional Source Beutler Lab
Gene Symbol Atmin
Ensembl Gene ENSMUSG00000047388
Gene NameATM interactor
Synonymsgpg6, Asciz
MMRRC Submission 040810-MU
Accession Numbers

Ncbi RefSeq: NM_177700.4; MGI:2682328

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3901 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location116943393-116960445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116956297 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 232 (N232S)
Ref Sequence ENSEMBL: ENSMUSP00000104727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109099]
Predicted Effect probably benign
Transcript: ENSMUST00000109099
AA Change: N232S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104727
Gene: ENSMUSG00000047388
AA Change: N232S

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 46 62 N/A INTRINSIC
ZnF_C2H2 80 105 2.49e-1 SMART
ZnF_C2H2 127 156 7.11e0 SMART
ZnF_C2H2 161 181 4.5e1 SMART
ZnF_C2H2 187 210 1.06e2 SMART
low complexity region 289 304 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
Meta Mutation Damage Score 0.0577 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (39/40)
MGI Phenotype Strain: 4868762; 4881337
Lethality: E16-E19
PHENOTYPE: Mice homozygous for a knock-out allele exhibit fetal lethality, craniofacial defects, midbrain exencephaly, and premature senescence of mouse embryonic fibroblasts. Homozygotes for an ENU-induced mutation exhibit left-right patterning defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adamts20 T A 15: 94,328,845 D1109V possibly damaging Het
Apc2 G C 10: 80,315,088 R1992P possibly damaging Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Casp16-ps A T 17: 23,552,948 V101E probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Clec7a A G 6: 129,468,914 S98P possibly damaging Het
Cpne5 G A 17: 29,159,108 R566C unknown Het
Csrnp1 C T 9: 119,972,641 E451K probably damaging Het
Dlst A G 12: 85,132,691 T435A possibly damaging Het
Dock8 A G 19: 25,100,905 T525A possibly damaging Het
Dync2li1 A G 17: 84,631,642 T45A probably damaging Het
Efcab3 A G 11: 105,083,887 N5307S possibly damaging Het
Epha4 A G 1: 77,380,902 Y820H probably damaging Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbn2 T A 18: 58,066,011 N1395I probably damaging Het
Fcnb T A 2: 28,079,196 Y163F probably damaging Het
Gm5444 T C 13: 4,834,279 noncoding transcript Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Kcnj3 A G 2: 55,437,348 N50D possibly damaging Het
Kcnma1 A G 14: 23,505,255 I416T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Lama5 C T 2: 180,182,351 probably benign Het
Lrp1b A G 2: 40,822,695 V3095A probably damaging Het
Mmp1a A G 9: 7,475,345 *372W probably null Het
Olfr867 C T 9: 20,054,873 V197I probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Pgap1 C T 1: 54,493,348 V671I probably benign Het
Pla2g4e T C 2: 120,168,604 S760G probably benign Het
Plk3 T C 4: 117,133,436 I94V probably benign Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Rims1 T A 1: 22,533,497 Q541L probably benign Het
Rptn A G 3: 93,398,357 Q999R probably benign Het
Stxbp5 A G 10: 9,769,419 L911P probably damaging Het
Tgfbr3 A G 5: 107,214,887 probably benign Het
Trim7 A T 11: 48,837,608 T28S probably damaging Het
Zfp595 T C 13: 67,317,315 I295V probably benign Het
Other mutations in Atmin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Atmin APN 8 116956657 missense probably damaging 1.00
IGL02680:Atmin APN 8 116957497 missense probably damaging 1.00
IGL03355:Atmin APN 8 116957425 nonsense probably null
K3955:Atmin UTSW 8 116957036 nonsense probably null
P0038:Atmin UTSW 8 116957036 nonsense probably null
R1440:Atmin UTSW 8 116957376 missense probably damaging 0.98
R1498:Atmin UTSW 8 116954801 missense probably benign 0.21
R1515:Atmin UTSW 8 116954840 missense possibly damaging 0.87
R2094:Atmin UTSW 8 116957538 missense probably damaging 1.00
R2306:Atmin UTSW 8 116957650 missense probably benign 0.04
R2363:Atmin UTSW 8 116954914 critical splice donor site probably null
R2866:Atmin UTSW 8 116956373 missense probably benign
R3743:Atmin UTSW 8 116956573 missense probably benign 0.02
R3902:Atmin UTSW 8 116956297 missense probably benign 0.00
R4664:Atmin UTSW 8 116957959 missense probably damaging 1.00
R4665:Atmin UTSW 8 116957959 missense probably damaging 1.00
R4666:Atmin UTSW 8 116957959 missense probably damaging 1.00
R5441:Atmin UTSW 8 116957957 missense probably damaging 0.99
R5496:Atmin UTSW 8 116957172 missense probably benign 0.01
R6914:Atmin UTSW 8 116956713 missense probably benign 0.02
R6942:Atmin UTSW 8 116956713 missense probably benign 0.02
R6965:Atmin UTSW 8 116957038 missense probably damaging 1.00
R7172:Atmin UTSW 8 116956542 missense probably damaging 1.00
R7492:Atmin UTSW 8 116956918 missense probably damaging 1.00
R7647:Atmin UTSW 8 116957922 missense possibly damaging 0.86
V7732:Atmin UTSW 8 116956479 missense probably damaging 1.00
X0020:Atmin UTSW 8 116952982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGCCAGAGTTAAGCAGCTC -3'
(R):5'- TTTAACCAGAGCCACCTTGGG -3'

Sequencing Primer
(F):5'- GCCAGAGTTAAGCAGCTCCAATC -3'
(R):5'- TGGTAACAGCAACTTCTGGG -3'
Posted On2015-04-17