Incidental Mutation 'R3901:Stxbp5'
ID 308986
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Name syntaxin binding protein 5 (tomosyn)
Synonyms LGL3, tomosyn 1, 0710001E20Rik, 4930565N16Rik
MMRRC Submission 040810-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3901 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 9631291-9776823 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9645163 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 911 (L911P)
Ref Sequence ENSEMBL: ENSMUSP00000123253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000136324] [ENSMUST00000141722]
AlphaFold Q8K400
Predicted Effect probably benign
Transcript: ENSMUST00000038213
AA Change: L947P

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: L947P

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000125200
AA Change: L894P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: L894P

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136259
Predicted Effect probably benign
Transcript: ENSMUST00000136324
SMART Domains Protein: ENSMUSP00000123355
Gene: ENSMUSG00000019790

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
low complexity region 209 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139199
Predicted Effect probably damaging
Transcript: ENSMUST00000141722
AA Change: L911P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: L911P

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151435
Meta Mutation Damage Score 0.7381 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,226,726 (GRCm39) D1109V possibly damaging Het
Apc2 G C 10: 80,150,922 (GRCm39) R1992P possibly damaging Het
Atmin A G 8: 117,683,036 (GRCm39) N232S probably benign Het
Brat1 A C 5: 140,703,751 (GRCm39) D668A possibly damaging Het
Casp16 A T 17: 23,771,922 (GRCm39) V101E probably damaging Het
Cass4 C T 2: 172,274,478 (GRCm39) P753L probably damaging Het
Cimip3 AC A 17: 47,744,348 (GRCm39) probably benign Het
Clec7a A G 6: 129,445,877 (GRCm39) S98P possibly damaging Het
Cpne5 G A 17: 29,378,082 (GRCm39) R566C unknown Het
Csrnp1 C T 9: 119,801,707 (GRCm39) E451K probably damaging Het
Dlst A G 12: 85,179,465 (GRCm39) T435A possibly damaging Het
Dock8 A G 19: 25,078,269 (GRCm39) T525A possibly damaging Het
Dync2li1 A G 17: 84,939,070 (GRCm39) T45A probably damaging Het
Efcab3 A G 11: 104,974,713 (GRCm39) N5307S possibly damaging Het
Epha4 A G 1: 77,357,539 (GRCm39) Y820H probably damaging Het
F5 A G 1: 164,003,798 (GRCm39) T198A probably benign Het
Fbn2 T A 18: 58,199,083 (GRCm39) N1395I probably damaging Het
Fcnb T A 2: 27,969,208 (GRCm39) Y163F probably damaging Het
Gm5444 T C 13: 4,884,278 (GRCm39) noncoding transcript Het
Jph3 G T 8: 122,480,158 (GRCm39) D279Y possibly damaging Het
Kcnj3 A G 2: 55,327,360 (GRCm39) N50D possibly damaging Het
Kcnma1 A G 14: 23,555,323 (GRCm39) I416T probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Kmt2e A G 5: 23,706,640 (GRCm39) N1401S probably benign Het
Lama5 C T 2: 179,824,144 (GRCm39) probably benign Het
Lrp1b A G 2: 40,712,707 (GRCm39) V3095A probably damaging Het
Mmp1a A G 9: 7,475,346 (GRCm39) *372W probably null Het
Or7d11 C T 9: 19,966,169 (GRCm39) V197I probably benign Het
Pdgfra T A 5: 75,353,169 (GRCm39) N986K probably benign Het
Pgap1 C T 1: 54,532,507 (GRCm39) V671I probably benign Het
Pla2g4e T C 2: 119,999,085 (GRCm39) S760G probably benign Het
Plk3 T C 4: 116,990,633 (GRCm39) I94V probably benign Het
Pogk C T 1: 166,231,193 (GRCm39) V45I probably damaging Het
Pou2f1 G C 1: 165,722,538 (GRCm39) P349R probably damaging Het
Rims1 T A 1: 22,572,578 (GRCm39) Q541L probably benign Het
Rptn A G 3: 93,305,664 (GRCm39) Q999R probably benign Het
Tgfbr3 A G 5: 107,362,753 (GRCm39) probably benign Het
Trim7 A T 11: 48,728,435 (GRCm39) T28S probably damaging Het
Zfp595 T C 13: 67,465,379 (GRCm39) I295V probably benign Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9,675,694 (GRCm39) missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9,684,346 (GRCm39) splice site probably benign
IGL01725:Stxbp5 APN 10 9,693,155 (GRCm39) missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9,638,565 (GRCm39) missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9,692,041 (GRCm39) missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9,638,700 (GRCm39) nonsense probably null
IGL02720:Stxbp5 APN 10 9,665,105 (GRCm39) critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9,692,034 (GRCm39) missense probably null 1.00
IGL03288:Stxbp5 APN 10 9,742,447 (GRCm39) splice site probably null
Fatty_fish UTSW 10 9,646,295 (GRCm39) missense probably damaging 1.00
reindeer UTSW 10 9,713,836 (GRCm39) missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9,645,187 (GRCm39) missense probably benign 0.36
PIT4544001:Stxbp5 UTSW 10 9,693,048 (GRCm39) critical splice donor site probably null
R0025:Stxbp5 UTSW 10 9,638,492 (GRCm39) missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9,638,492 (GRCm39) missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9,646,272 (GRCm39) missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9,742,442 (GRCm39) splice site probably benign
R0631:Stxbp5 UTSW 10 9,660,102 (GRCm39) missense probably benign
R0723:Stxbp5 UTSW 10 9,644,617 (GRCm39) missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9,740,843 (GRCm39) missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9,740,843 (GRCm39) missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9,684,784 (GRCm39) missense possibly damaging 0.86
R1225:Stxbp5 UTSW 10 9,688,135 (GRCm39) missense possibly damaging 0.94
R1271:Stxbp5 UTSW 10 9,692,013 (GRCm39) missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9,713,836 (GRCm39) missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1902:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1917:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9,711,590 (GRCm39) missense possibly damaging 0.69
R3773:Stxbp5 UTSW 10 9,644,671 (GRCm39) missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9,665,060 (GRCm39) intron probably benign
R4572:Stxbp5 UTSW 10 9,713,888 (GRCm39) missense probably damaging 0.99
R4764:Stxbp5 UTSW 10 9,646,367 (GRCm39) missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9,638,635 (GRCm39) missense probably benign 0.06
R4842:Stxbp5 UTSW 10 9,638,635 (GRCm39) missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9,688,085 (GRCm39) nonsense probably null
R4887:Stxbp5 UTSW 10 9,684,844 (GRCm39) missense probably benign
R4930:Stxbp5 UTSW 10 9,636,610 (GRCm39) utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9,646,295 (GRCm39) missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9,674,019 (GRCm39) critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9,675,735 (GRCm39) missense probably damaging 1.00
R5455:Stxbp5 UTSW 10 9,684,252 (GRCm39) missense probably benign
R5531:Stxbp5 UTSW 10 9,638,668 (GRCm39) nonsense probably null
R5605:Stxbp5 UTSW 10 9,645,490 (GRCm39) intron probably benign
R5614:Stxbp5 UTSW 10 9,636,638 (GRCm39) utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9,776,330 (GRCm39) missense probably benign
R5990:Stxbp5 UTSW 10 9,711,677 (GRCm39) missense probably damaging 1.00
R6025:Stxbp5 UTSW 10 9,675,772 (GRCm39) missense probably benign 0.00
R6056:Stxbp5 UTSW 10 9,646,430 (GRCm39) missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9,684,216 (GRCm39) missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9,693,083 (GRCm39) missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9,642,931 (GRCm39) missense probably damaging 1.00
R6284:Stxbp5 UTSW 10 9,642,923 (GRCm39) missense probably benign 0.32
R6394:Stxbp5 UTSW 10 9,774,975 (GRCm39) nonsense probably null
R6427:Stxbp5 UTSW 10 9,774,998 (GRCm39) missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9,660,105 (GRCm39) missense probably benign 0.00
R7229:Stxbp5 UTSW 10 9,673,931 (GRCm39) missense probably damaging 1.00
R7337:Stxbp5 UTSW 10 9,684,874 (GRCm39) missense possibly damaging 0.93
R7686:Stxbp5 UTSW 10 9,645,154 (GRCm39) missense probably damaging 0.99
R7811:Stxbp5 UTSW 10 9,684,248 (GRCm39) missense probably benign
R7974:Stxbp5 UTSW 10 9,646,439 (GRCm39) splice site probably null
R8009:Stxbp5 UTSW 10 9,692,046 (GRCm39) missense probably damaging 1.00
R8287:Stxbp5 UTSW 10 9,660,129 (GRCm39) missense probably benign
R8353:Stxbp5 UTSW 10 9,684,792 (GRCm39) missense probably benign 0.30
R8360:Stxbp5 UTSW 10 9,688,003 (GRCm39) critical splice donor site probably null
R8453:Stxbp5 UTSW 10 9,684,792 (GRCm39) missense probably benign 0.30
R8487:Stxbp5 UTSW 10 9,688,033 (GRCm39) missense possibly damaging 0.80
R8548:Stxbp5 UTSW 10 9,693,050 (GRCm39) missense probably null 0.98
R8805:Stxbp5 UTSW 10 9,713,859 (GRCm39) nonsense probably null
R9172:Stxbp5 UTSW 10 9,645,152 (GRCm39) missense possibly damaging 0.94
R9472:Stxbp5 UTSW 10 9,719,101 (GRCm39) missense probably damaging 1.00
R9513:Stxbp5 UTSW 10 9,687,754 (GRCm39) missense probably benign 0.17
R9649:Stxbp5 UTSW 10 9,774,938 (GRCm39) missense probably damaging 0.96
X0020:Stxbp5 UTSW 10 9,638,634 (GRCm39) missense possibly damaging 0.47
Z1176:Stxbp5 UTSW 10 9,776,289 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCACTACTCTGAATGCTAGCC -3'
(R):5'- CTGGAAAGAACACAACGTTGC -3'

Sequencing Primer
(F):5'- GCTAGCCTACAAAATTAATGACAGAG -3'
(R):5'- AAGAACACAACGTTGCTGAAG -3'
Posted On 2015-04-17