Incidental Mutation 'R3901:Trim7'
ID308988
Institutional Source Beutler Lab
Gene Symbol Trim7
Ensembl Gene ENSMUSG00000040350
Gene Nametripartite motif-containing 7
Synonyms
MMRRC Submission 040810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R3901 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location48826140-48852209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48837608 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 28 (T28S)
Ref Sequence ENSEMBL: ENSMUSP00000039011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046903] [ENSMUST00000109213] [ENSMUST00000129674] [ENSMUST00000149049] [ENSMUST00000155478]
Predicted Effect probably damaging
Transcript: ENSMUST00000046903
AA Change: T28S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039011
Gene: ENSMUSG00000040350
AA Change: T28S

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
RING 29 80 2.95e-7 SMART
BBOX 124 165 3.23e-13 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 246 271 N/A INTRINSIC
low complexity region 285 304 N/A INTRINSIC
PRY 340 392 4.61e-18 SMART
SPRY 393 506 1.63e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109213
SMART Domains Protein: ENSMUSP00000104836
Gene: ENSMUSG00000040350

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
coiled coil region 39 64 N/A INTRINSIC
low complexity region 78 97 N/A INTRINSIC
PRY 133 185 4.61e-18 SMART
SPRY 186 299 1.63e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129674
SMART Domains Protein: ENSMUSP00000116067
Gene: ENSMUSG00000040350

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149049
Predicted Effect possibly damaging
Transcript: ENSMUST00000155478
AA Change: T28S

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118669
Gene: ENSMUSG00000040350
AA Change: T28S

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
RING 29 80 2.95e-7 SMART
BBOX 124 165 3.23e-13 SMART
low complexity region 221 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216796
Meta Mutation Damage Score 0.1512 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1, a B-box type 2, and a coiled-coil region. The protein localizes to both the nucleus and the cytoplasm, and may represent a participant in the initiation of glycogen synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adamts20 T A 15: 94,328,845 D1109V possibly damaging Het
Apc2 G C 10: 80,315,088 R1992P possibly damaging Het
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Casp16-ps A T 17: 23,552,948 V101E probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Clec7a A G 6: 129,468,914 S98P possibly damaging Het
Cpne5 G A 17: 29,159,108 R566C unknown Het
Csrnp1 C T 9: 119,972,641 E451K probably damaging Het
Dlst A G 12: 85,132,691 T435A possibly damaging Het
Dock8 A G 19: 25,100,905 T525A possibly damaging Het
Dync2li1 A G 17: 84,631,642 T45A probably damaging Het
Efcab3 A G 11: 105,083,887 N5307S possibly damaging Het
Epha4 A G 1: 77,380,902 Y820H probably damaging Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbn2 T A 18: 58,066,011 N1395I probably damaging Het
Fcnb T A 2: 28,079,196 Y163F probably damaging Het
Gm5444 T C 13: 4,834,279 noncoding transcript Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Kcnj3 A G 2: 55,437,348 N50D possibly damaging Het
Kcnma1 A G 14: 23,505,255 I416T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Lama5 C T 2: 180,182,351 probably benign Het
Lrp1b A G 2: 40,822,695 V3095A probably damaging Het
Mmp1a A G 9: 7,475,345 *372W probably null Het
Olfr867 C T 9: 20,054,873 V197I probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Pgap1 C T 1: 54,493,348 V671I probably benign Het
Pla2g4e T C 2: 120,168,604 S760G probably benign Het
Plk3 T C 4: 117,133,436 I94V probably benign Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Rims1 T A 1: 22,533,497 Q541L probably benign Het
Rptn A G 3: 93,398,357 Q999R probably benign Het
Stxbp5 A G 10: 9,769,419 L911P probably damaging Het
Tgfbr3 A G 5: 107,214,887 probably benign Het
Zfp595 T C 13: 67,317,315 I295V probably benign Het
Other mutations in Trim7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Trim7 APN 11 48845571 missense probably damaging 0.99
IGL00476:Trim7 APN 11 48848078 missense probably benign 0.39
R0119:Trim7 UTSW 11 48849712 missense probably damaging 1.00
R0308:Trim7 UTSW 11 48849501 missense probably damaging 0.96
R0546:Trim7 UTSW 11 48845509 missense probably damaging 1.00
R1067:Trim7 UTSW 11 48837819 missense probably damaging 0.99
R1081:Trim7 UTSW 11 48849705 missense probably damaging 1.00
R2139:Trim7 UTSW 11 48838894 missense probably benign 0.06
R3796:Trim7 UTSW 11 48845670 splice site probably null
R3797:Trim7 UTSW 11 48845670 splice site probably null
R4157:Trim7 UTSW 11 48848093 missense probably benign 0.00
R4603:Trim7 UTSW 11 48837528 start codon destroyed probably null 0.98
R5429:Trim7 UTSW 11 48849955 missense probably damaging 1.00
R5915:Trim7 UTSW 11 48845650 missense possibly damaging 0.95
R5988:Trim7 UTSW 11 48837686 missense probably benign 0.01
Z1176:Trim7 UTSW 11 48849893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACTGGGCGGCCTAGAAAG -3'
(R):5'- CTTGGCAGTAGAGCTTAAGTTG -3'

Sequencing Primer
(F):5'- ATTCTCAGCTGGGTGCAC -3'
(R):5'- AGCTTAAGTTGCTCTCCGTG -3'
Posted On2015-04-17