Incidental Mutation 'R3901:Dlst'
ID308989
Institutional Source Beutler Lab
Gene Symbol Dlst
Ensembl Gene ENSMUSG00000004789
Gene Namedihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
Synonyms
MMRRC Submission 040810-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R3901 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location85110833-85134845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85132691 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 435 (T435A)
Ref Sequence ENSEMBL: ENSMUSP00000152664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019379] [ENSMUST00000053811] [ENSMUST00000221357] [ENSMUST00000221972] [ENSMUST00000223332]
Predicted Effect probably benign
Transcript: ENSMUST00000019379
SMART Domains Protein: ENSMUSP00000019379
Gene: ENSMUSG00000019235

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
MIT 46 123 8.99e-25 SMART
low complexity region 155 166 N/A INTRINSIC
Pfam:Pkinase_Tyr 178 519 1.9e-12 PFAM
Pfam:Pkinase 367 534 1.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000053811
AA Change: T435A

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000060346
Gene: ENSMUSG00000004789
AA Change: T435A

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 72 144 1.7e-22 PFAM
low complexity region 149 180 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 205 217 N/A INTRINSIC
Pfam:2-oxoacid_dh 221 452 2.3e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220633
Predicted Effect possibly damaging
Transcript: ENSMUST00000221357
AA Change: T435A

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000221972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222472
Predicted Effect probably benign
Transcript: ENSMUST00000223332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223438
Meta Mutation Damage Score 0.1185 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that belongs to the 2-oxoacid dehydrogenase family. This protein is one of the three components (the E2 component) of the 2-oxoglutarate dehydrogenase complex that catalyzes the overall conversion of 2-oxoglutarate to succinyl-CoA and CO(2). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice heterozygous for a gene trap allele exhibit an accelerates amyloid pathology and memory deficit in a transgenic mouse model of amyloid deposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adamts20 T A 15: 94,328,845 D1109V possibly damaging Het
Apc2 G C 10: 80,315,088 R1992P possibly damaging Het
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Casp16-ps A T 17: 23,552,948 V101E probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Clec7a A G 6: 129,468,914 S98P possibly damaging Het
Cpne5 G A 17: 29,159,108 R566C unknown Het
Csrnp1 C T 9: 119,972,641 E451K probably damaging Het
Dock8 A G 19: 25,100,905 T525A possibly damaging Het
Dync2li1 A G 17: 84,631,642 T45A probably damaging Het
Efcab3 A G 11: 105,083,887 N5307S possibly damaging Het
Epha4 A G 1: 77,380,902 Y820H probably damaging Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbn2 T A 18: 58,066,011 N1395I probably damaging Het
Fcnb T A 2: 28,079,196 Y163F probably damaging Het
Gm5444 T C 13: 4,834,279 noncoding transcript Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Kcnj3 A G 2: 55,437,348 N50D possibly damaging Het
Kcnma1 A G 14: 23,505,255 I416T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Lama5 C T 2: 180,182,351 probably benign Het
Lrp1b A G 2: 40,822,695 V3095A probably damaging Het
Mmp1a A G 9: 7,475,345 *372W probably null Het
Olfr867 C T 9: 20,054,873 V197I probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Pgap1 C T 1: 54,493,348 V671I probably benign Het
Pla2g4e T C 2: 120,168,604 S760G probably benign Het
Plk3 T C 4: 117,133,436 I94V probably benign Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Rims1 T A 1: 22,533,497 Q541L probably benign Het
Rptn A G 3: 93,398,357 Q999R probably benign Het
Stxbp5 A G 10: 9,769,419 L911P probably damaging Het
Tgfbr3 A G 5: 107,214,887 probably benign Het
Trim7 A T 11: 48,837,608 T28S probably damaging Het
Zfp595 T C 13: 67,317,315 I295V probably benign Het
Other mutations in Dlst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02120:Dlst APN 12 85118568 missense probably benign 0.01
IGL02150:Dlst APN 12 85131033 missense possibly damaging 0.91
IGL02223:Dlst APN 12 85130918 missense probably benign 0.13
I1329:Dlst UTSW 12 85123841 missense probably damaging 1.00
R0331:Dlst UTSW 12 85118812 missense probably damaging 1.00
R1087:Dlst UTSW 12 85132639 missense probably damaging 1.00
R1218:Dlst UTSW 12 85123864 missense probably damaging 1.00
R4705:Dlst UTSW 12 85118842 splice site probably null
R5457:Dlst UTSW 12 85122140 critical splice donor site probably null
R6039:Dlst UTSW 12 85118890 intron probably null
R6039:Dlst UTSW 12 85118890 intron probably null
R6422:Dlst UTSW 12 85130885 splice site probably null
R7078:Dlst UTSW 12 85110931 missense probably benign 0.03
R7366:Dlst UTSW 12 85128315 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTTTGCAACTAGAACCATTGGG -3'
(R):5'- CTTGTGAACGCTGGTTACATCG -3'

Sequencing Primer
(F):5'- GTGGGCTTTGCTTTCTCAC -3'
(R):5'- CTTGAGGCCAATAGTATGTGCC -3'
Posted On2015-04-17