Incidental Mutation 'R0379:Scaf11'
ID30900
Institutional Source Beutler Lab
Gene Symbol Scaf11
Ensembl Gene ENSMUSG00000033228
Gene NameSR-related CTD-associated factor 11
SynonymsSrsf2ip, Sfrs2ip, SIP1, CASP11, 1110061H03Rik, SRRP129, 2610510E10Rik
MMRRC Submission 038585-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0379 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location96411699-96460843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96431816 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 143 (L143S)
Ref Sequence ENSEMBL: ENSMUSP00000154321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047835] [ENSMUST00000227069] [ENSMUST00000228535]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047835
AA Change: L143S

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044898
Gene: ENSMUSG00000033228
AA Change: L143S

DomainStartEndE-ValueType
RING 41 81 1.57e-2 SMART
low complexity region 308 327 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 919 978 N/A INTRINSIC
low complexity region 1089 1108 N/A INTRINSIC
low complexity region 1177 1188 N/A INTRINSIC
low complexity region 1283 1311 N/A INTRINSIC
low complexity region 1346 1359 N/A INTRINSIC
Blast:IG_like 1374 1415 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000227069
AA Change: L143S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228260
Predicted Effect probably damaging
Transcript: ENSMUST00000228535
AA Change: L81S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.8060 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,785,546 probably benign Het
4930512M02Rik A G 11: 11,589,365 probably benign Het
Apba1 A C 19: 23,934,830 N558T probably damaging Het
Arfgef2 T A 2: 166,860,400 probably null Het
Arsb T C 13: 93,940,627 S501P probably benign Het
Atp10b A G 11: 43,254,314 T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 R648L probably damaging Het
Bcl2a1b T C 9: 89,199,736 I126T possibly damaging Het
Brd9 T C 13: 73,942,683 probably benign Het
Cd93 T C 2: 148,441,510 probably benign Het
Chd5 A G 4: 152,383,321 K1692R probably benign Het
Clcn4 T C 7: 7,296,792 T13A probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Clec4g A G 8: 3,718,440 V97A probably benign Het
Col24a1 G A 3: 145,524,142 R1483K possibly damaging Het
Crem A T 18: 3,299,226 V82D probably damaging Het
Ctnna2 T A 6: 77,641,440 T180S probably benign Het
Cybrd1 T C 2: 71,129,755 I99T probably benign Het
Cyp4a32 G A 4: 115,621,474 V468M probably damaging Het
Dlk1 A G 12: 109,455,059 probably benign Het
Dnah7b A T 1: 46,140,176 Y1003F probably benign Het
Egfem1 A C 3: 29,668,250 E376A possibly damaging Het
Etl4 T A 2: 20,807,354 I1416K probably damaging Het
Fbxl4 A G 4: 22,386,106 T238A probably benign Het
Fer1l6 A G 15: 58,548,338 I33M probably benign Het
Fndc3a A G 14: 72,556,609 S830P probably damaging Het
Fras1 C T 5: 96,755,509 R3082* probably null Het
Galnt13 T C 2: 55,060,492 V395A possibly damaging Het
Gm10334 T G 6: 41,445,256 probably benign Het
Gpd2 C T 2: 57,345,263 T335I probably damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Hydin A G 8: 110,509,127 probably benign Het
Ints5 G T 19: 8,897,133 V819L possibly damaging Het
Klhdc10 C G 6: 30,450,670 Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,479 A67T probably benign Het
Lrp1 T G 10: 127,594,969 T404P probably damaging Het
March7 T C 2: 60,234,126 S249P probably benign Het
Mcm10 T A 2: 5,008,623 K66M probably benign Het
Mtmr7 C A 8: 40,551,601 D645Y probably damaging Het
Muc6 T A 7: 141,636,955 I2602F possibly damaging Het
Myh13 G A 11: 67,369,295 probably benign Het
Myo18a G A 11: 77,850,806 V1776I possibly damaging Het
Ncapg2 T C 12: 116,443,075 L957S probably damaging Het
Ncoa3 T C 2: 166,054,502 S442P probably damaging Het
Olfr1093 G A 2: 86,785,735 E2K probably benign Het
Olfr850 T A 9: 19,477,480 T257S possibly damaging Het
Olfr986 G A 9: 40,187,433 G106D probably damaging Het
Pdcd6 G T 13: 74,309,712 N113K possibly damaging Het
Pfkfb4 C T 9: 109,027,742 probably benign Het
Pfkm A G 15: 98,126,314 H401R probably benign Het
Phldb2 C A 16: 45,781,451 D754Y probably damaging Het
Plekhb2 T A 1: 34,863,114 M49K probably damaging Het
Polrmt A G 10: 79,737,611 S1057P possibly damaging Het
Prps1l1 A G 12: 34,985,078 N64S probably benign Het
Psg16 T C 7: 17,130,658 S393P probably benign Het
Rundc1 C T 11: 101,425,147 T15I probably benign Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpinf1 T G 11: 75,413,945 I197L probably benign Het
Siglec1 C T 2: 131,074,525 probably benign Het
Slc28a1 G A 7: 81,138,177 V271I probably benign Het
Sntg1 T C 1: 8,782,824 D34G probably damaging Het
Sptbn4 A T 7: 27,359,736 probably benign Het
Suclg1 T C 6: 73,256,228 I51T possibly damaging Het
Syne1 C T 10: 5,541,989 R9Q probably damaging Het
Trim47 T A 11: 116,106,518 H470L probably damaging Het
Ttc41 T A 10: 86,712,977 Y12N possibly damaging Het
Tubgcp2 T C 7: 140,032,192 E69G probably damaging Het
Tubgcp3 G A 8: 12,641,116 T474M probably damaging Het
Ubr5 A T 15: 38,018,957 N777K probably benign Het
Ush2a T C 1: 188,451,819 L1440P probably damaging Het
Usp28 A C 9: 49,024,067 D458A possibly damaging Het
Vcan A T 13: 89,703,546 D1098E probably damaging Het
Vmn1r73 C T 7: 11,756,846 T197I probably benign Het
Vmn2r15 T C 5: 109,286,478 S787G probably damaging Het
Vmn2r90 T A 17: 17,728,139 I549N probably damaging Het
Vps33b T A 7: 80,283,414 probably null Het
Zfp516 A T 18: 82,987,670 K900* probably null Het
Zfp974 T A 7: 27,910,932 N456I probably damaging Het
Other mutations in Scaf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Scaf11 APN 15 96418580 missense possibly damaging 0.94
IGL01386:Scaf11 APN 15 96420480 missense probably damaging 1.00
IGL01449:Scaf11 APN 15 96419126 missense probably benign 0.04
IGL01547:Scaf11 APN 15 96418429 missense probably benign 0.14
IGL01697:Scaf11 APN 15 96423623 splice site probably benign
IGL01780:Scaf11 APN 15 96420844 missense possibly damaging 0.94
IGL02311:Scaf11 APN 15 96418756 missense probably benign 0.01
IGL02740:Scaf11 APN 15 96419002 missense probably benign 0.01
IGL02805:Scaf11 APN 15 96420182 missense possibly damaging 0.69
IGL03383:Scaf11 APN 15 96420183 unclassified probably null
R0173:Scaf11 UTSW 15 96420194 missense probably benign 0.00
R0508:Scaf11 UTSW 15 96420487 missense probably damaging 1.00
R0648:Scaf11 UTSW 15 96418458 missense possibly damaging 0.72
R0653:Scaf11 UTSW 15 96418641 nonsense probably null
R0727:Scaf11 UTSW 15 96419443 missense probably damaging 1.00
R0829:Scaf11 UTSW 15 96418689 missense probably damaging 1.00
R0839:Scaf11 UTSW 15 96423553 missense probably damaging 1.00
R0843:Scaf11 UTSW 15 96431825 missense probably damaging 1.00
R0882:Scaf11 UTSW 15 96418295 missense possibly damaging 0.75
R1994:Scaf11 UTSW 15 96418840 nonsense probably null
R2092:Scaf11 UTSW 15 96415827 missense probably damaging 0.98
R2125:Scaf11 UTSW 15 96419315 missense possibly damaging 0.69
R2200:Scaf11 UTSW 15 96420523 missense probably damaging 1.00
R3409:Scaf11 UTSW 15 96414864 missense probably damaging 1.00
R3751:Scaf11 UTSW 15 96418536 missense probably damaging 0.99
R4308:Scaf11 UTSW 15 96446515 missense probably benign 0.00
R4424:Scaf11 UTSW 15 96418428 missense possibly damaging 0.78
R4519:Scaf11 UTSW 15 96424838 missense probably damaging 1.00
R4646:Scaf11 UTSW 15 96420100 unclassified probably null
R4647:Scaf11 UTSW 15 96420100 unclassified probably null
R4724:Scaf11 UTSW 15 96414848 missense probably benign 0.40
R4748:Scaf11 UTSW 15 96420421 nonsense probably null
R4926:Scaf11 UTSW 15 96418242 missense possibly damaging 0.87
R4978:Scaf11 UTSW 15 96415917 missense probably damaging 1.00
R5105:Scaf11 UTSW 15 96420432 missense probably damaging 1.00
R5120:Scaf11 UTSW 15 96419542 missense probably benign 0.26
R5277:Scaf11 UTSW 15 96419226 missense probably damaging 1.00
R5377:Scaf11 UTSW 15 96417120 missense possibly damaging 0.55
R5394:Scaf11 UTSW 15 96419458 missense probably benign 0.28
R5481:Scaf11 UTSW 15 96420617 missense probably damaging 1.00
R5831:Scaf11 UTSW 15 96417081 missense probably benign 0.14
R5941:Scaf11 UTSW 15 96420308 missense probably damaging 0.99
R6123:Scaf11 UTSW 15 96420454 missense probably benign 0.29
R6166:Scaf11 UTSW 15 96424662 missense probably damaging 1.00
R6504:Scaf11 UTSW 15 96419460 unclassified probably null
R6863:Scaf11 UTSW 15 96419419 missense probably damaging 1.00
R7135:Scaf11 UTSW 15 96420328 missense possibly damaging 0.82
R7193:Scaf11 UTSW 15 96419161 missense probably damaging 1.00
R7384:Scaf11 UTSW 15 96420387 missense possibly damaging 0.92
R7790:Scaf11 UTSW 15 96419061 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GCTCAGCCAGTCCATGCCAATATC -3'
(R):5'- AGCAATGCCCTCTATTCTGCATGTC -3'

Sequencing Primer
(F):5'- TCAGGAGATGGTCTTTCAACAC -3'
(R):5'- TCTCGGTAGCCAGTCATGAAAG -3'
Posted On2013-04-24