Incidental Mutation 'R3897:Tmem203'
ID309003
Institutional Source Beutler Lab
Gene Symbol Tmem203
Ensembl Gene ENSMUSG00000078201
Gene Nametransmembrane protein 203
Synonyms
MMRRC Submission 040808-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3897 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25255439-25256292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25255923 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 85 (F85S)
Ref Sequence ENSEMBL: ENSMUSP00000100614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100329] [ENSMUST00000104998] [ENSMUST00000114349] [ENSMUST00000132128] [ENSMUST00000147866] [ENSMUST00000148589] [ENSMUST00000228052]
Predicted Effect probably benign
Transcript: ENSMUST00000100329
SMART Domains Protein: ENSMUSP00000097903
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 8 124 2.3e-23 PFAM
Pfam:FAD_binding_1 134 354 8e-50 PFAM
Pfam:NAD_binding_1 389 495 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000104998
AA Change: F85S

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000100614
Gene: ENSMUSG00000078201
AA Change: F85S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 79 101 N/A INTRINSIC
transmembrane domain 111 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114349
SMART Domains Protein: ENSMUSP00000109989
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 8 145 2.3e-32 PFAM
Pfam:FAD_binding_1 201 421 2e-48 PFAM
Pfam:NAD_binding_1 456 561 1.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132128
SMART Domains Protein: ENSMUSP00000125018
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
PDB:4H2D|B 1 48 2e-9 PDB
SCOP:d1f4pa_ 4 57 4e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137355
Predicted Effect probably benign
Transcript: ENSMUST00000141808
SMART Domains Protein: ENSMUSP00000123247
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 7 120 8.1e-25 PFAM
Pfam:FAD_binding_1 167 225 9.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147866
SMART Domains Protein: ENSMUSP00000125259
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Pfam:Flavodoxin_1 93 196 4.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148589
SMART Domains Protein: ENSMUSP00000123958
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
PDB:4H2D|B 1 49 7e-10 PDB
SCOP:d1f4pa_ 4 45 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228052
Meta Mutation Damage Score 0.0874 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, abnormal calcium homeostasis, arreasted spermiation, azoospermia, male infertility and reduced total litter numbers in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,438 D316G possibly damaging Het
Adam15 T C 3: 89,346,938 H184R probably benign Het
Ap1g1 A G 8: 109,854,999 D633G probably damaging Het
Arhgef28 C T 13: 97,956,576 R999H probably damaging Het
Armc3 T C 2: 19,269,177 S341P probably damaging Het
Cmya5 T C 13: 93,096,681 E633G possibly damaging Het
Colgalt1 G A 8: 71,619,662 M275I probably damaging Het
Commd7 T C 2: 153,622,790 T23A probably benign Het
Cts3 A G 13: 61,564,986 Y307H probably benign Het
Dlgap4 C A 2: 156,746,069 P89Q probably damaging Het
Ecm1 A G 3: 95,735,986 L334P probably damaging Het
Fzd8 G A 18: 9,214,939 V674I possibly damaging Het
Gosr2 A G 11: 103,697,646 Y5H possibly damaging Het
Gria4 T A 9: 4,513,260 D283V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqcm C T 8: 75,753,400 R329C probably damaging Het
Kdm4b T C 17: 56,396,955 C233R probably damaging Het
Ltbp1 T C 17: 75,274,016 C391R probably damaging Het
Man2b1 G T 8: 85,096,948 probably benign Het
Nisch A G 14: 31,191,000 probably benign Het
Nrxn2 T G 19: 6,519,257 D1394E probably damaging Het
Olfr1259 T C 2: 89,943,809 E102G probably benign Het
Olfr1283 T C 2: 111,368,761 L43P possibly damaging Het
Pabpc6 T C 17: 9,669,127 D165G probably benign Het
Psat1 A G 19: 15,919,453 probably null Het
Psd A C 19: 46,324,585 N115K possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnf144a A G 12: 26,310,713 V275A probably damaging Het
Slc35b3 A G 13: 38,934,763 F356L probably benign Het
Tmc4 A G 7: 3,671,088 V364A probably benign Het
Tra2a T C 6: 49,245,542 probably benign Het
Ttc21b C T 2: 66,235,069 E454K probably benign Het
Other mutations in Tmem203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Tmem203 APN 2 25255724 missense probably benign
R1794:Tmem203 UTSW 2 25255994 missense probably benign
R3827:Tmem203 UTSW 2 25256006 missense possibly damaging 0.53
R4747:Tmem203 UTSW 2 25255752 missense probably benign 0.01
R5735:Tmem203 UTSW 2 25256073 missense probably benign 0.10
R6627:Tmem203 UTSW 2 25255773 splice site probably null
R7555:Tmem203 UTSW 2 25255730 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCGCCACCTTTGAGATATTCGTG -3'
(R):5'- AGTGCTCCATTTCCAGCCAC -3'

Sequencing Primer
(F):5'- TGAGATATTCGTGCACCTGC -3'
(R):5'- CCACTGCAAGAGGCTAGTTGAC -3'
Posted On2015-04-17