Incidental Mutation 'R3897:Commd7'
ID309006
Institutional Source Beutler Lab
Gene Symbol Commd7
Ensembl Gene ENSMUSG00000056941
Gene NameCOMM domain containing 7
SynonymsmU3, 2310010I22Rik
MMRRC Submission 040808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R3897 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location153616933-153632781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 153622790 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 23 (T23A)
Ref Sequence ENSEMBL: ENSMUSP00000105404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071852] [ENSMUST00000109782]
Predicted Effect probably benign
Transcript: ENSMUST00000071852
AA Change: T94A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071752
Gene: ENSMUSG00000056941
AA Change: T94A

DomainStartEndE-ValueType
Pfam:HCaRG 19 199 3.8e-44 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000109782
AA Change: T23A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105404
Gene: ENSMUSG00000056941
AA Change: T23A

DomainStartEndE-ValueType
Pfam:HCaRG 1 127 4.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147822
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,438 D316G possibly damaging Het
Adam15 T C 3: 89,346,938 H184R probably benign Het
Ap1g1 A G 8: 109,854,999 D633G probably damaging Het
Arhgef28 C T 13: 97,956,576 R999H probably damaging Het
Armc3 T C 2: 19,269,177 S341P probably damaging Het
Cmya5 T C 13: 93,096,681 E633G possibly damaging Het
Colgalt1 G A 8: 71,619,662 M275I probably damaging Het
Cts3 A G 13: 61,564,986 Y307H probably benign Het
Dlgap4 C A 2: 156,746,069 P89Q probably damaging Het
Ecm1 A G 3: 95,735,986 L334P probably damaging Het
Fzd8 G A 18: 9,214,939 V674I possibly damaging Het
Gosr2 A G 11: 103,697,646 Y5H possibly damaging Het
Gria4 T A 9: 4,513,260 D283V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqcm C T 8: 75,753,400 R329C probably damaging Het
Kdm4b T C 17: 56,396,955 C233R probably damaging Het
Ltbp1 T C 17: 75,274,016 C391R probably damaging Het
Man2b1 G T 8: 85,096,948 probably benign Het
Nisch A G 14: 31,191,000 probably benign Het
Nrxn2 T G 19: 6,519,257 D1394E probably damaging Het
Olfr1259 T C 2: 89,943,809 E102G probably benign Het
Olfr1283 T C 2: 111,368,761 L43P possibly damaging Het
Pabpc6 T C 17: 9,669,127 D165G probably benign Het
Psat1 A G 19: 15,919,453 probably null Het
Psd A C 19: 46,324,585 N115K possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnf144a A G 12: 26,310,713 V275A probably damaging Het
Slc35b3 A G 13: 38,934,763 F356L probably benign Het
Tmc4 A G 7: 3,671,088 V364A probably benign Het
Tmem203 T C 2: 25,255,923 F85S probably benign Het
Tra2a T C 6: 49,245,542 probably benign Het
Ttc21b C T 2: 66,235,069 E454K probably benign Het
Other mutations in Commd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03392:Commd7 APN 2 153622764 splice site probably benign
R1065:Commd7 UTSW 2 153619527 splice site probably benign
R1131:Commd7 UTSW 2 153622127 missense probably benign 0.00
R2132:Commd7 UTSW 2 153621666 intron probably benign
R5837:Commd7 UTSW 2 153629224 missense possibly damaging 0.79
R5902:Commd7 UTSW 2 153621817 missense probably damaging 1.00
R6207:Commd7 UTSW 2 153632610 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TCTTTCAGCAGGGCATCAGG -3'
(R):5'- GGCTGCATTTTCTCGTCAGC -3'

Sequencing Primer
(F):5'- GGAAGCCCAGCTGACCTTAAATTTTC -3'
(R):5'- CCACTGGATCGAGACCGTTAC -3'
Posted On2015-04-17